Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18835  (registered. 2007)
Contig Information
Length 1208 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0144400 [Oryza sativa (japonica cultivar-group)] >gi|75288644|sp|Q60EX6|BSL1_ORYSJ RecName: Full=Serine/threonine protein phosphatase BSL1 homolog; AltName: Full=BSU1-like protein 1 homolog >gi|53749344|gb|AAU90203.1| putative Serine/threonine protein phosphatase BSL1 [Oryza sativa (japonica cultivar-group)] >gi|113578176|dbj|BAF16539.1| Os05g0144400 [Oryza sativa (japonica cultivar-group)] >gi|215767692|dbj|BAG99920.1| unnamed protein product [Oryza sativa Japonica Group]
Score 907
Evalue 1.29426e-95
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18835
TTTTTTTTTTAGGAAGGTATTCTTATATTCCTCCTACGCTCCAAACAGGATACAACTTAAACCAACCACTTGGTTCAGGTTACTCAAATAAACTTAATTT
ATTCCTATAACAAATTTAATCAACAACAACAGACTTCAGTTACAACATCACGGGGAGGTAGTTTTCCTCCAGCCAATCTAACTCAGTAAAACTTGTATAG
CTGCGCTGTGCAAGCAGCGTCCTAAACGGTAACGAACACGGTATACGGAACAATACGGAACACATTACAAGCCTTCTTGCTCTGGATGAACAATGATCTA
ACCATGTACAACACTACAGTTACAGGTAAACCACGACAACGATACACACACGGACTCCTGCTTTCCGACAATTATCTGACAACATTCAATTCCTCCCTTC
AGAACTGTTATGTATGTAGCTTCCCAATAAGGGGCTGACTGCACTGAACACTGATGAGTCACTATCAACTTAACTACCGGGCAAATGTCTCGAAAATTTG
GGAGTCCATGATGCTCTGTTGGCTGGCTTCCCTAGGTATAATGTATGTACCTTGCAACTGGCAAAGAAGTTTCTGACGAGAAACATACAGGGTCAAGAAG
ATGGAGGGGCCGGCTATGTATATCATATGTAAGCAAGAGAGTTCCTGTCACCAGCAGAATGCGGCCGTCCTCTAGTTGGTGTAGGTGGCCGTTGTATGTT
AAGTTCCTGCATCCATGTGGCATCCATGGCACGTTCAGGAGATGACTCGGGAGAATTAACAGGTGGTGGAAGTGGATGAATTAACTTTGGGACAATAACT
AGTCCCCTTCCCACCACAAGTATGGCGCCAGCATTATTTGCAGTGCCACAATAATTAGTGGCTGAAAATAAAGTGATCAACTGCCCATGGGCGAAACGCT
CAAATCCATCCATAACACACTCATGAGCTCTTATGATCAATTGCAATTTGTTTCGTTTACAGAATTCTGCCACTCGGTCAGGCCCAAATGTTACCAAGCC
AGGTCCTCGTGCATTTGGCCTCAAACCCTCTACACTATCGTTTTCTGTAGGATCAGACCATAAAAGATCCATGAGGACAATAGATCCGACATCCATTGTA
ATAGGCCTTTCAATTTTTTCAATTTGCTCCACACTGTTTATTGACCTCCCGATGCCACCATGCATGCATATTATTTTCTTTTCTATCATAGCAGCCAGAG
GGAGATAA
page-top