Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18834  (registered. 2007)
Contig Information
Length 1092 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0195500 [Oryza sativa (japonica cultivar-group)] >gi|113531822|dbj|BAF04205.1| Os01g0195500 [Oryza sativa (japonica cultivar-group)]
Score 763
Evalue 5.57898e-79
Total Hit Count 220
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18834
CACAGACTGTTCCTATGAAAGCAGACGAGACTGGAGCACTACTAATCTGCACTTATCTCTGCAGGTCCACGGATAGTTGGTACTGAATTGTTTTGAAACT
AGGATTCAAAAGCACATTAAACCATATAAATCACATATGGATGTCATACTCGCCTTGCAGGAGGAACTCGACTATCAAATAAAAGATGATACACGAAGGC
GACGTGCCAGCGGTAGTTAAAACACCACTTGTGAACTGACCCACAAGTCAAAATGGAGCGGGTTGTGTCTTGGGAGTAAGGATTAAGAACCCATGTGACA
GGCATGCCTTAACGGCCGTCTCTTGCCTTATATTTCTATCATATTTGTAACTCCACTGGTGTATGCCTTGTAAACCATATGTAATCAAGCAGCAGCAACC
TTCCTTCCATCTTCTATGAAATATACGGCGGATTCAGGAACATCAGGCCATGTAGCTGTAATGAAGTCCACAACATCATATGATATGTCTCCTTGGACAT
CAATTTGCTCCTTCTCAGTTGGGCCCTTGACAACCGAAGCTCCAGTAGCAAACTTCTTTCCAAGCTTCTTTGAAGCATCACTCAGCTTTACACCAAACAA
ATCCAGGCCTTTCACCACAGTAACACACTTGCGCTTGTTGCGGACAATCTTCTCAATAATAACCTCTTGCTTGTCCTTTTTCTTGAGCTTACCGCCCGGC
AGTCGCTTCACCTCTTCAGTCTTAGAAGATGCCGAAGCACCCCCTGCGCTTGTGGAGCCGTCGGCGGTGGAGATGCTGACGCCCTGGAGGCGCTCGCCGA
CCTTGCCCACGTCCTTATCGTCGCCGCCGGAGGAGGAGGCCACGAGCTCGTCGGGGTAGACGCCGGGCGCGTGGGCGCGGAGCCACGGCTTGCAGCGCTC
GAAGTCGGGGCCGAACTCGCAGTACTCCGCGGGGAGGCCGCACACGCCGCAGTAGAGCACCTTCGCCGGGGCCAGCTTCTCCGCCGCCATCACCGCCGCC
GGATTCGATCCGATCTGATGGGGAATGCTCGACGAGGTGGGCTGCGCGAATCTGTGTTGCCCTGCTCGAGCGCTCGTGGAGTCGTGACGGAT
page-top