Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18832  (registered. 2007)
Contig Information
Length 1023 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit biostress-resistance-related protein [Triticum aestivum]
Score 1181
Evalue 1.70838e-127
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18832
GATCACAACTTTGGATGGAAACACATACCAAATATATGGAAATCTCAATAGTACCAAGATTCAGCGAGGCATGTCCGCATATGAAACACCAAGCTAAGAC
ATGACCGTATACCCAAAGCCCAAGTTGGCAACCCAGCCATTTTATCACTCAATTCGGCACAACCACAGGTACTTATTATTTAGACGCCGCTACACCGAGC
CTTTCTCAAGGCATCTCTTCATTCGATCAAGTTGACGTGGAACTGCCGAGTTCCAAGCTTGCCGTAAGCCACTTGACGACTTCGTCCATCTCCTCTGGAA
CGGTATAGTGCCCGAGTCTGCTGTAGGACTTGAATTCCACATTTGCAAACCCGGTTGACTTAAGTGCATCAGCAGACCTCTCTCCATGTTTGTAGAGGAC
CACATCATCAGCTTTTCCATGACAAAGCATAAGAGGTAATGATGAAGCCTTCTGTGCAGCCTCCTGTGAGCTCTCAATTTTGTTCTTCAATGACCTGGCG
CATGGGAGCCAGCCACTGAGACCAACAGCCACACTTAGGTTCACAGGGTAAGGATTGCCATTTCCATATTTTCCATGAGCAAAGCAAGTACCGGAGTAAA
GCGCAGTAGCAGCACCCATACTAAAGCCACCAACGCCAAGCTTGATATCTGCAGGTTCGGTAGACAATAAATTTGCAACATGTGCAGCTGAGGAATCCAG
CCCCTCAACATCATCAGGAGAATCTTCTGAAAGATCAGCAACATCAAACCATGCAGTAGATGGGAATCCACCAAAAATTGCCACAGGCCTCGTAGGTGCA
GTTGGGCAGATCCATTTTATATTAGGAAGGGGAAGAGTTTCCAACAGTTGAGACCAGCTGGCTCCATTGTCGCCGAGGCCGTGGAGCCAGACGATGGTGG
CCTTGTGCGCGCCCTTGGGCCTCACCACATGCGTCCTCCCGTACTCGAACGGCCGCTTCCCACCGGCCGCGACGGAGCTGGCGCCGCCGAAGCTCATCCC
GCGAACAGTCGCCGCCGCCGCCC
page-top