Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18815  (registered. 2007)
Contig Information
Length 964 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 1094
Evalue 2.61459e-120
Total Hit Count 421
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18815
TTTTTTTTTTACAGACTTGCTAACAATCTTCAGTGTAAATGGAAGGCTTGCTAACAATCTTCAGTGTAAATGGTTATGGCTTGCTAACAATATTCAGTGT
AAATGATAACCATTTCCTGCTCAAATCAAGTTTAACATAACTGCTGTGAAGCAGCAGGAATTGTCTTACACTTCGTAACATAACTACCGCTACTAGTACA
TCAGAGCAAAACAGATAGCAGAAACAACACAGCCACTTCTTTTCTTCCTCTTTAACTTCACTTTTGCTTCTTGGGCATCCTGTAACCACCAACTACGCAA
GCGTGGTCGCGCTCGAAGGGCTCCAGGGTCACCTGCTCTGAGGGCTTGAACTGGTCGGCCTTGAGCTTCTCCACTTCACTGGCGAACACGGCCTCGGCCG
CCTGGGTGGAGTCGATACAGTTTGCCTTGATGGAAATGACAAAGTGGCCTCCATTCTTCAAGAAGTATGATGCGTTAAGGGCTAAGATTCTAGCCTGGTC
AGGCTGTGCAACATCTGAAAAGATAACATCAACCATGCCGACCAGCATCCGGTACTTTGCCGGGTGCCTAGCATCCTCAATGATGGGGATGACATTGGTC
CTCTTCTTGGCCATGTTGACAAGATCCCTACCACTCCGGTGAGAGAACTCAACGGCATACACCAACCCAGTCGGTCCAACGATGTCAGACACATGAGACA
CGGTTGTTCCAGAGGCAGCTCCGAGGTACAGCACACGTGTTCCAGGAGCAATCCAGATGTTGTCCACACCACCGAGCACAGCAGCAGCCAGCTTGGACCT
GAAGGGGTTCCACACCCTGTACTCAACCTTGGATCCGTCCTCGTTCTGGACGGAGACCCTCTTCTCGCCGTAGACGGACTCGCCGGCGACCATGTTCTTG
GTGCANAGCGCGTCCCTCCTTGGCCCTTGGCGATGAAGACGCCGTCGTGCTTGTGCGGCACGAC
page-top