Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18740  (registered. 2007)
Contig Information
Length 1289 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0233400 [Oryza sativa (japonica cultivar-group)] >gi|51535194|dbj|BAD38167.1| putative leucine zipper protein [Oryza sativa Japonica Group] >gi|113595272|dbj|BAF19146.1| Os06g0233400 [Oryza sativa (japonica cultivar-group)] >gi|125554661|gb|EAZ00267.1| hypothetical protein OsI_22278 [Oryza sativa Indica Group] >gi|215692522|dbj|BAG87942.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704433|dbj|BAG93867.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1229
Evalue 6.49432e-133
Total Hit Count 353
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18740
TTTTTTTTTTGCATTACCTCATAGCAAGGTGCCCCATCTGGCAACAATCAATCAATACCGATAGCACAAGTTCGCATTACCTCATACCTGGACCTACATG
AACTATAGACCCATCGCCCATTCAGCAGTAAACCAATAACTGTTTTGGGTATGCTGTAGCAGATAGGGGCAGCACAAAATACAAACTAGATTGATAGTTT
GCAATCCTAGCCAGTGAAACAACCCCTGCGCAAGTAGATTCCACCAAACGACATCATCTGCTTTGTGAAGGGTAGCGGGAACAATGCCGACATCCAAAGA
TAAATACTCTATTGATCGACATGAATCATGTTTGTACCACCAAATCATGATATCCAAGTCAGAATGCAGCCTCAAACGGTTCACTTGTTACGCTGAACGC
ATCCATTCTCGGTTAGGTACTCCACAAATTCATCAATTAGGTAGGGCCAAGCACCTTCTTCGTCATAGTTGGATAACTGTGGATCAATTGTCTTGACAAA
TTCCAACAGCTGAGACCATGTGTCCCTAGAGATGGCTTTGTTATGCCTGACCTGTAGAAACTGACACCAGTGATCAATTAAGGGCCAATGCCTTTCAGCA
AACAGCAACCTCCACATTCCAATAGCTGTCTCCAGTGGAAGGGATTTCTGACCCTTTTCCCTAGCCCAAGCAAACGCAAAGTTGTATATCTCACGGAACT
TATTATCGTCCTTTATCTCAGCTCGCAGTGATGGAAGTTTCTCACGGAGCTTCTCAATTGAATCTACCCCAATTGACTGCAGACCATCAATGAATTCCTG
GCGAGTAAATTCACACATTGTGGCAGCTTTCATGTGCCATGATATGACAAGCATGACAACATCCTGAGGATCCACCAACAGGTCGTTGCACAGTTGAGAT
GTGCCTTCCACCATGATCATATCAGCGTCACGTTCTTTGTATCTGCTGTAAAGATCTTCAAGATGTCGAGAATTGGTCACAGAAATCTGTGGCTGGCTGT
AGAAATAATCAAAAGACCCTTCTAAGTGCCAATCACTAGCTTTCAGTGCCTGAAGGGCGACCTTCTCGCTTGCACCAGTTATGGCCATGAACTGTTGCAC
CTTGTCGCGGCTTCCTCTCCCCAGCTTATGCATGGTCCCCGCGTAGATCTCCCGACGCCCGAGAGGGAGATCAAGGAGGATGGGATTGCCGTCGATCTGG
TCGCCGGGAAATGATGGGCGGCAGCCGATAGCCGGGGCGTCGACGGAGAGGGTCGCCGGGAGACGCGACAGCGAGAGGGAGCAGGAGGC
page-top