Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18738  (registered. 2007)
Contig Information
Length 1862 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group] >gi|125597285|gb|EAZ37065.1| hypothetical protein OsJ_020548 [Oryza sativa (japonica cultivar-group)]
Score 957
Evalue 3.65439e-101
Total Hit Count 159
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18738
AAATGGCAATATGCGGTGTTAGCATCCACACATCAGCAGCTTTATAAGAGTTGCCACTGGTATGCCACTTTGCATGTTCACGGACATACAACTCACAAAA
TAAAGATGTAGGATCTAAATGACACCCAAGCAGGTTTAGTTGCCCGCTGGTATATTTACTCGCAACAACAGCCGCTAAGGTACTGTAAACAAAGCCAAGC
TAAAATACGATGACATAACCTGAGCAACGGCACATGGTACATTTGCAGAACATAAATATCTTTACAGTGTATCTATATGAATAACTCTCTCCAGCAAAGC
TTGCCCCCAGGTTTCAAGGCACAGCAATCTAACTCCATAACACCTTCAATCAAGCAAACCCACTTTCTCGATCACAAGTATTCGCATCTTGCACCTCAGT
TTGCTCAACGGAGTCACTTTTGCTTTCTTGACCACAAGTATTCGTATCTTGCACCTCAGTTTGCCCAAGGGAATCACTTCTACCTGGAGTCCTGATATGT
TTGGAGATTCCACTGGCAAGGAAGTAGCGCATAAAACCAAGGTGCCTCTTGGGTAGCTTCGCCACTCCTCGCAGAGTCCGCATACTGAGATCAACAGAGA
ATACTGTCGGCATAGCCCTCATGCCGGTGCCCTTGGCCAACAAGTAAACAATATCATCACCATCCGTGATGCTCAAGGTAGGGTAAGCCATGCGTAGAGA
TTCCAGGGACAAGACTTCCTCTGCAGCATTCCCCTCCTTGTTGGCGCTTCCGCTCATGAGCTTATGCAACAGCTTATAATGCCTTTTGACATCAGCAGGA
ATATCAATCTCAGTCGACAGGGCGGAGCATTGAAATTGCCAGCCATTCAATGAAGTGACCGGGATAGGCATGCTCCATGTGGTGGCCCTCCAGGCACCAC
CGTGCAGGTTCATCTTGACATACTTGATAGTGCTTTTGCTCTGGTCGACAATGATGTCACGGAAATAGTAGGGGCAGCAGTCAAGGAATAACCTCCAATC
ACTCTTAGAGACAGAAGGCAGAGGCACGTCACGGAGCGTGGGGCTAATTTCCAGCACGTCGCAGAGAAGGATGCCTCGCCAGAGATCGACCCAGCCAACG
GTACCTTTAGCACCACCAAGCGTGATCACCTTTGTTGTCCGATGATACGTAAGCATCTGCGATGCGAGAGAGATCGAGGACGAGTTGTCCCTCGGCAGCT
CCTTCACATTCAGCTCTACATCCAGCAGCTTGGAGGTCCAACTCCCTGGCTTGCCATCAGGTCTAGACCGGTACACGTGAAGCTTAAAGGTACACATACC
CAAGGTTTGAAGGGAGGCCACAGCGTACTTGCCGTCGCCGCAGCTCAGTATGGCGATCTCCTTATCTCCAAAGTAATATGGAGCAGACTTCGGGAGAAGG
TCCAGCTTTGGGATTTGGGAGTGCGCCCTGTAGACGAAGTAGTCGCTAAACATCGGATTAGAGTCGCCAAAGGGTTGGACGGGGACGCGGAGGAGAACGA
GGTCAGCATCCGCGCTGATGACCTTGGGCGCCAGGGACAAACCCTCGGGTTCCGGGCATGCCGCGCTGCTGAAGGAGAAGTGCGAGAGGACTGGCGGGCG
GGCGGCGCAGAAAGTCACCGCGATGGGCAGGCCGGTACTCGTCTTGGACGTGGCGGTGGTGGCGTTGCGGCTGGGGCCGATTTGGCCAAAGAGGTCGAGT
ATGACGGAGCTTGGGATATAGTGGCGGCCCTTGCCCTCGCGGCTCGCAAGGACGGCAGCTGTCGCCATGGATTCCGATTGGTCAATCGACGACCAAATCG
GAGAAGACTGGAGCTTCAATTGGATTTGGGATCTGGGGGCGGAAGGAGCGTGAGCCGGCGGC
page-top