Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18727  (registered. 2007)
Contig Information
Length 872 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_29037 [Oryza sativa Indica Group]
Score 898
Evalue 8.54577e-95
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18727
GGTCCCGCCCGCCCGGGGCCGCTGAAAGATGATAAACCTTTTTAAGATCAAGGGGCAGAAGAAGGAAGAGGCAGCCAACTCAAATGGAGGGCCTCCTGTT
AAGAAGCAAAGTCCAGGGGAATTACGTCTCCATAAAGATATTGCTGAGCTTAACCTTCCAAAGACGACTAAAATTTCCTTCCCAAATGGGAAGGATGATC
TCATGAACTTTGAAGCTACTCTACGACCTGATGAAGGATACTATCTAGGCGGGTCATTCACTTTCACCTTCCAAGTATCTCCTTCCTACCCTCACGAGGC
TCCGAAGGTCAAATGCAAAACTAAGGTTTACCATCCCAATATTGACCTAGAAGGAAATGTGTGCCTGAACATTCTGCGTGAAGACTGGAAGCCTGTCTTG
AATATCAACACCATTATCTATGGTTTAAACCTTCTTTTCTCACAACCCAACGACGAGGACCCCTTGAATCATGAAGCCGCGGCCGTCCTCCGGGACAACC
CGCAGAAGTTCCAGAGAAACGTTCAGATGGCAATGTCGGGAGGCTATGTCGATAACACCCATTTCCCAAGGTGCAAGTAAGGCGGCCGGGCGGGCCTGCT
ACGTGCTTGCTTCTGGCTTGCGCCCACCTACCCTACCCTAGCCCTGAATGCCAAACCATTGCACAATCTGAAGAAATGCGGGCGGCATACCCAGGAAATG
TATCTATCATACTTGTTTGTGTCAAGAAGATGTGACTGCTATTGTGCTTGTTTGGTGGATGTTCTGGAATTGTCGTGTAACATGAAGAAGAAATGGGGTG
ACGTTATGTAGCGAAACTCGCCTGTATTGAGCTGAAAATTAAGTCACGGGTGTTGATCTGTCAAAAAAAAAA
page-top