Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18703  (registered. 2007)
Contig Information
Length 701 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195623302|gb|ACG33481.1| vacuolar ATP synthase 16 kDa proteolipid subunit [Zea mays] >gi|195638000|gb|ACG38468.1| vacuolar ATP synthase 16 kDa proteolipid subunit [Zea mays]
Score 420
Evalue 1.51582e-39
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18703
TTTTTTTTTTAAAGTGGAACTAGGTCTAGCTTTGCTTATTCATTCATATCACATCCCAAGAGGCTCATCGCCGATTATTACTCCAAACAATAAATACAAC
AGGTGCTAGGTACGACGAGTAGATACAGGTAGCTTTGCGTTGCCGAACATAGAATAAAATTACAGATGGCGGGCGTGGAAATCCCTATGATCCCAAACCA
CATTATGTTCCTCCGCCGAGGAGCATGAACACAGAAGTAGAACCACAGTGTTTGCCAAACAAGTCTCTAAGAAGAAATGAACCCTTTCAAACAGAATACA
ATGATGGACCGTATGCTCCTTGCTTGCAAGCGCTTTGTTTCTAGTCGGCGCGGGATTGGCCGGCACGCGAGGAGAGGATGATGCCGACGATGAGGCCGTA
CAGGGCAAGAGCTTCGGCAAAGATGAGGATGAGGATCATGCCGACGAACAGCTTGGGCTGCTGTGCGTTGGCCCTGACGCCGGCGTCGCCGACGATGCCG
ATGGCCATGCCGGCGGCGAGCCCCGCGAGGCCGCAGGCGAGGCCGGAGGAGAGGTGCGCGTAGCCGTCGAAGAGGAAGTAGGGCTTGGCCTTGGGGTTGA
TCCCGGTGGAGATGATGACGGCGATGATGAGACCGTANATCCCGAGCACCCCGGCCATGACGACGGGCACGATGGACTTCATCACCANCTCCGGCCGCAT
C
page-top