Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18668  (registered. 2007)
Contig Information
Length 974 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_009494 [Oryza sativa (japonica cultivar-group)]
Score 639
Evalue 1.11118e-64
Total Hit Count 189
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18668
ACACACAGCCCATCCCCGCAGGGCCGAGATCCCCGCCCCACTCCTCCGGACAACCGCCGCCGACTCGCCGGCCCTCACCGCCTTCCCGGCCGCCGGCGCT
CCCGCTGTAGTACGTTGCAGGACTTCGTGTGCTCTTCTTCACCAGTGCCGTCTAAGATGGTGTCCTTTGAGATGAATGACCTTAAGAAGATAGGGCTAGG
CCTGACAGGCTTTGGAGTATTCTTCTCCTTCCTGGGAATCGTTTTCTTCTTTGACAAGGGGCTTATTGCTATGGGCAATATACTCTTCCTGTCAGGTTTG
GGTTTGACAATTGGTCTGAAATCAACTATGCAGTTCTTCACAAAGCCTAAGAATTACAAGGGTACCATCTCATTTGGCGCAGGCTTTTTCCTGGTTCTCA
TTGGATGGCCTTTCTTTGGCATGCTCTTAGAGGCATATGGTTTTATCGTACTCTTCAGTGGGTTCTGGCCAACTCTCGCAGTTTTCCTGCAAAGGATTCC
TATCCTTGGCTGGATTTTTCAACAACCATTTGTCACTTCGTTCCTTGACCGTTACAGAGGGAAACGAGTGCCGGTGTAGTATCATTTCGTGCTATGTTTC
TTATGTAGCAGCTGAAGTTTTTTTCCTTCCCTGGGGATAACAGCAAGTAGTTGTGCCATCCTGGTCTTTCCCTTTACCTGTTTACTTACTGGTGACTGTC
CTTTGTAAATTACACCCCCGGATGGTTTTGTCAAAGACCAAGATGCAAATTGTCCCATGGTATGGGCTGAAGAAACTTCATAAGTGAACCCGTACGATTC
AAATATGTAGCTGTAGAGGAATATGCTGCTGAAGTAGAAGCTACATGTTACGTCTCTTTTGTACTTACGTTCAGATATAGATATTCCGGTCCCTCGAGTC
TTGAGCTTGTGTTTGCTTTATTTTTGTGCGCACTTCATAGCTTGAAGAAAGGCAAATATGTGCTGGAACTGAAA
page-top