Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18506  (registered. 2007)
Contig Information
Length 1042 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RNA binding protein [Zea mays] >gi|195627448|gb|ACG35554.1| RNA binding protein [Zea mays]
Score 282
Evalue 3.01887e-48
Total Hit Count 29
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18506
TAGTACAACTGGAATTAACTAGGCAGGGCAAAGCAAAGCAAAGCTAGCTTGCTGGGTCCTTTTCAATCCACATTTCAAGGTGGAAAGCAAGCAGACTTGC
ACAATAACATCCACAACCACAATAAGCTAGGTGCAACATTCTTGTTTTCTTCATATTACACTACAGGTGACAGGCCTCCACATGCCCTGCCACTTAATGT
CGACAAAACGCACTGACTACTATATCTTTGACAGATTGGGCCGTAAGTTTATGATGTCATGCCCAAATTCAACAAGCATAAATACATTAGGTGTACAGGT
GGACGGTAACCATAGGATGATGACTATTCCCAAGTCGTCTACCAGTTCAAGAATCAGAATCACTTTCTGTATCGGAATGCACGTCAAACGGTCTATTTCT
GTTCGTGTTTGCCTCAAGTGGCGGCATATCATCATCGTCGTCTTCATCAGAGTTGTGCTCTTCCTCAGCCTGTGATGTCGTTCCTTGTGGCCCTGTCGCC
CACCCATTGGGAGTTGACTTGAAGATAGCCGGCCATTGGCCGGATTTCTCGAGGGCGCGAACCTGGTCGTGAAAGAGGACGCGCGAGACGACACAGGCTA
TCTTGCTTCCAGATTCGAGAGCCTCGTCCCTGCCACTAGCATCCACAACCACGAAATTCCCTGCACATTCATTCATTCATTCATTCATTCAGAGCAGAGC
AGACCATCATCATCATCAACTGACTGACCGTTCTTGATCCAGAAGCTCTTCTGGAACTTGGCGGGGAAGAGGGCGAGAGACTTGACGCCCTCGCCGTCGG
TGACCTACAACGGCGGCAGCAGGACGGAGTGAGGAAGAAGCAATTTTTAAGAGAGGGAGGGAGAGAGGGTAGGTACCTCGATGAGGTTGGAGCCGCGCAG
CGTGACGACCTGCATGATGCTCTCGCCCTCCGCCAGCGTCACCGCGGTGCCCTCCTCGCACGCGCGACGCAGGTTCTTCCTCCCGCCCTTCATGCCCTCC
TCAACGGACGGACGGCGGCGGCGGCGGCGTCGGTCCGCTCGG
page-top