Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18476  (registered. 2007)
Contig Information
Length 794 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_29419 [Oryza sativa Indica Group] (no hit)
Score 1434
Evalue 9.64865e-157
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18476
CCATATATATAATTGTTTCACATCAGACACACACACGTATGTATTTATATCACAAGAACAATTAACTGGAGACCAATCATCAGCAAGTACAGAATATATA
TGACATATATAGCTAGTTCTTACACATCAACAAAAGAACACCTCACAAGCACAAGTCTAAAACAGTCACATAATTGTACAGTACTATTTCTTATGAATTA
CAGAGAGAAAGAGAGAGAGAAAGCAACAGCAACTTCAGTTGGTGAAGAAGAGCAGCAGGAGCGTGGGGTTCAGCAGCAGGTTCAGAGAAGGTTGAGATAG
AGAGAGAGCAGCAGCAGCAGCGGAGGTAAGGAAGAGAAGCAGCAGCAGGGAGTTCAGAGAAGGCTTCAGCAGAGGCGCAGCATGCAGTTGGGAGATGGAG
AAGGAGCAGCAGCGTTGAGAGAGCAGCAGGGGGCGCAGTAGAAGAAGAGCAGCTGCAAAAGGGATTGAAAGAGAAGGCAGCAAGCAGCGGCGGGAAGAAG
AGGCTGCAGCAGTAGGGGCGCATGAAAAGGAGCAGCAGCAAAGAGGATCAGCAGGCAGAGCAAGCAGGTGGAGGCGCGCGGGTGATCAGACGCCCGCAAC
CCCTGTGTCTGGACGTCCGCGCGAGGTGCGGCAGTGGCTGGAGATGGTGGTGAGTGGTGGATGCTGATGTTGGTGCTGGTGAATGGATGGCGCTGGGTGC
TAGTGGTATGGTAGATGGAGGGGCTGCGGAGGCGCACCACCACGCCGGCCTGGCCGTGGCGGCGGCTGGAGGTGGAGAAGGAGGGGTAGGGAGA
page-top