Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11353  (registered. 2012)
Contig Information
Length 815 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218190486|gb|EEC72913.1|| hypothetical protein OsI_06742 [Oryza sativa Indica Group]
Score 322
Evalue 3.00E-86
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11353
TCAGGACTACAATCGTTTCATGTGGCTGCAGTGGTCGAGCCTTTTGGGGATTTTAACCAGGATTGGCAGTACTGTGTATGCGTACGAGTGATTCACTGCT
AAGACTGCATTATTAGCACTTGACTTTCATTGGCTCATCGGTATGTACGTGATTGGCTGTTCTTTCAGTATTCAGATTGTGCCTCGCAGTCTGTTTCTTT
GATTCGGTTTACGCCTGAACCAGCAGCCCCGTTCGATGCCCTTCAATCAACCCTCCCTTGCGGCTTCCAGGAGCTCATTCCATCTGGTGATCTTCTCCCT
AGGCTTGTTCTTCAGCTCGCCGTCCGCCTTCTCTTTGGTGTCGATCTTCTCCCAGCCATCAAACGGCACGTAGCGGGCATTCTTCTGTTCCAGAATCTCA
AGTAGTCCCCGCCGGCCTTGCCTTTTCGGACCAGATGGGTCCGTGAACAAGCCCTTCCTGTCGTCTTCAAGGATGCTATCCACCGTTTCTTCGGCACAAT
GGAGATTTGTAGCAACAATCCCAGTTGGTCCTCTCTTCAACCATCCTACCACGTACAGTCCTGGCTCCACCGTGGCAGTCTCTGATTCACTGGACAGAAC
TCTGCCCCTCAAATTTGGGACAACTCCTCTGTATTTGTCGAAGGACAAACCTTCTATTGGCAAGGATTTGTAACCAATACTCTTCAAAACAATTCCACAT
TTTAGTTCTTCAAACTCACCAGTTCCAACTGCCACCTGCTTTCCAGTTGCTCCATCATCTTTTAAGAGAGTCTTTTCAAGTTCCATAGCACCAACCGTGG
AACCATCTTCTGAAG
page-top