Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18347  (registered. 2007)
Contig Information
Length 1194 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_V483 Shoot grown under cold condition for 3days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phosphomannomutase; AltName: Full=TaPMM >gi|90762172|gb|ABD97875.1| phosphomannomutase [Triticum aestivum]
Score 1231
Evalue 3.43138e-133
Total Hit Count 278
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18347
TTTTTTTTTTGAGCAGGAAATATCTTAGATCAAACATGCCCTCATACAATTGCGCCCAATGCGCGTATACAAAATCCGCTGCTTGTGAATGTATGTATAC
CAATACAGTTCTGTTTACAACAACAATAGTGATAAGCTACTCCCAACGGGGAGGAACACAAAAAATGTACTGAGTTCAAAGGGAGATCTATAGAGGAATT
ATTTCGAGACGGCAAGTGTTCGAGGGGTGCAGGTGAACAAATGAATGTAAACGGCACGGTAGTCTGGCGATCACTCCGACAGGAAGATGGATTTGCACTG
CTGCACAGTGTCATTGGGGCTGGTAACTGTATGACCAACTGTTCTGTCAGATTCAAATATCTCATGATCATTGCCACCCTTGTAGGTTTTGTCCCCAAAG
AAATGGATTTCTTTGAATTCTTCCAGATATCTCAAGCAGTAGGTTTTGTCCCAGCCTTGTGGGAATACATCAAAACTGATCTGCCCTCCAATAGAAAAAG
TCAGGTTCAGGTGTGCAAACTTTTCACGAAGCACTGAGACCATTTTAGGCCGAACGTTATGTACCTTATCATACTTCTCAAAATCATCACGTTCTTGTTG
ACTACAGTTCCTCCCTATAGGTGACACATTGATCATTCCACTCCTGAACTCTATGAATGTACCCCTTTTAATTGGGATATCCAAGTCCGCAATGTAATGA
AGAGTGAAGTTAATGAATTCCTTAAGCTGGTCATCTCCAAGATACGTTTTCAAGCTTTGCGTCCCGATGAGCTTGCCGTCCTTGTGCGCGACCAGGCCGT
TCTCGGAGAAGACGTAGTCATAGTCGGTGATGACTGATTTGCCGAGCTGCTCGGAGATCTTGACCAGATCGGATCCCCCCACCACGCCGACGGTCACATT
CTCGCGCAGGCGCTTCATGAACTCGAGCATCTCGGGCGTCACCTCCTTGCGGGCCGCGGTGAGTGTGCCGTCGACGTCGAAGAGCGCGAGCACACCGGCG
TTCTTCCTCGCCGCCGCCGCCGCCATCTTCCTCCTGCTGCTGAAGCTGCTGCTACGAAGAAGAAGAAGAAGGGACGGGGCGCTCCTCCTCGCGGCGGCCG
CGTGATATAGCGCCCCCGGGGTGGTCGCCGGGAGGAGGATGCGTGCGGCGGAGAAAGAAGTCAGCTTTGCGGCGCGGATCCAGATGCGCCGGGG
page-top