Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11349  (registered. 2012)
Contig Information
Length 1163 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VWD Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 19
WH_XF Seedling, infected with leaf rust 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242056227|ref|XP_002457259.1|| hypothetical protein SORBIDRAFT_03g004300 [Sorghum bicolor]
Score 420
Evalue 2.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11349
GATGCAACGGCTGTTCATGCTTGGCATTCTTGTACCCAACCCAACACAGACCCGCGGTGTCAATAGGAACAGTCAGGGAGGGGGCCCTGATACAACTGTG
CTAAGCTGACCCACTTCATTTATTCATCCGGGTATCACACAGTACATCAAATTACTAAGCCCCAAAACTTTTCCGCCGTAAAGCGAGCGACTACTACCAG
GGTTCAGTTCTTTCTACATGATCCTTAACGAACTACTTTCTTCAAACACTAAACTTTAACCGAGGCTCTTGACCACCTTCTCAGCCTTTTCCTTCAGAAC
ATGTAAAGTTACCGTGCGAGCATCAGCAGCACCAACACCGTGGTAGATCCGATCCGGGAGCACTTCACATCACATCTACTACCAGTAATTTTTCGGCATT
ATCGACGGCCAAGACTCGCTCAGGAAGCCTCAACGGCGTGGAAGAACGGCTGGAGGATCCACTCGTAGGCTATGTATGCGTCGCCCTCATCGTGTACTCT
GCCACAAGCTTTGAGAACAGGGACGACTTGTTCTCCAGCAGCTTGGCCGGCGTGTCATGCTCCACGGCCACACCGTTGTCGAGGAGCAGAACCATGTCGC
TGTCGAGGACCGAGGTGATTCGATGCGCAATCGTGATGACCGTCGCCTCCGAGAAGTTCTCACGCAGCGTTTTCTGGATCATGTTGTCTGTCGCGGTATC
CACTGAGGCAGTGGCTTCGTCCAGAACCAGTATCTTGGTCCGTTTCAGAATCACTCTTCCGAGACAGACTAGCTGGCGCTGGCCCACGCTCCAGTTCTCT
CCGTTCTCGATCACTGGCGAGTCGAGTTTCAGCTCCTTCTTCCTGACCTCATCTCCCAGCTGACAGTTATCCAAGGCCTCCCAGATTTGATCGTCATTGT
ACTCGTTAAGAGGGTCAAGGTTGCTCCTCACAGTTCCCTCAAACATCGTTGGATCTTGTGGAATGATGCTAAGTCTAGATCTCAGATCGTGCAGCCCGAT
GGTGCAGATGTCAACACCATCTACCAGTATCTGACCGACAGTAGGCTCGACAATTCGGAAAAGGGCCTGTATGAGTGTTGATTTACCACTGCCTGTTCTT
CCAACAATACCGGTCTTCATGCCTCCAGGAAAAGTGACGTTAAGGCCCTTCAGAACAAATGGT
page-top