Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18339  (registered. 2007)
Contig Information
Length 1198 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0585500 [Oryza sativa (japonica cultivar-group)] >gi|48843805|gb|AAT47064.1| putative calcium-dependent protein kinase [Oryza sativa (japonica cultivar-group)] >gi|113580006|dbj|BAF18369.1| Os05g0585500 [Oryza sativa (japonica cultivar-group)]
Score 1252
Evalue 1.26485e-135
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18339
GCCTTTCTGGGCAGAGAATGAAGAAGGTATATTTGATGCTGTTCTGAAAGGTCACATTGATTTCTCGTCTGATCCCTGGCCATCGATTTCAAATGGGGCT
AAAGACTTGGTCAAGAGGATGCTACGGCAGGACCCCAAGGAGCGGCTCACGGCTGCGGAAATATTGAATCATCCATGGATCAGAGAGGATGGAGAGGCCC
CAGACAAACCACTTGATATTACAGTGATCAGTAGAATGAAGCAGTTCAGGGCGATGAACAAGCTTAAGAAGGTTGCCTTGAAGATTGTTGCAGAGAGCTT
GTCAGAGGAAGAGATCGTGGGCTTAAGAGAAATGTTCAAGTCCCTGGATACTGATAACAGTGGGACAATTACTCTTGATGAACTAAGGGCTGGCTTACCA
AAGCTTGGGACCAAAATTACTGAATCAGAAATAAGACAGTTAATGGAGGCGGCTGATGTTGATGGAAATGGGACCATTGATTATGTTGAATTCATATCGG
CAACAATGCACATGAATAGACTAGAGAAGGAAGACCACATATTTAAAGCATTTGAATACTTTGACAAGGACCACAGCGGGTACATAACAGTTGATGAGTT
GGAGGAAGCTCTGAAGAAGTATGATATGGGTGATGAGGCAACAATTAAAGATATCATTGCTGAAGTGGATACAGATCATGATGGGAAAATTAACTACCAG
GAGTTTGTTGCGATGATGAAGAACAACAGTCCAGAGATTGTTCCAAATCGACGCCGCCTATTTTAAATCTTGCAATGGTTTATGCGAAGCTTGCGATTCC
TGTGAATGCATTTAGACAGGTGACCAGTCAAGATCTTAATTGGCGAGGAATGAGCGAAGCCATTCATGCTTGGCCACGGAATTTAGTAAGGTATCTGCAA
GTGATCCTTTATACTTGGAACACACTATCCATCATTGGGAACTCTCCCCTTCAACGTGTTCTGAGCTAGGTCGCACTTTCTTGTGCTACCATGTTATACC
ATTCACATGTATCCTTATGAGTTATGACTTATGAGGCGAGCCGTCTGGTTTTGTGTTTCCTCCAATTGATCATTTATGTAAGAATGGATTTGTAAAACAC
TTAAATGATCATATCAAGGAAGATCACGCTCCTAGATGAATATAGCGCAAAGGAAGGTATCCGCAAGCGATCCTTTGTACTTGGACACAAAAAAAAAA
page-top