Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18322  (registered. 2007)
Contig Information
Length 819 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13865 [Oryza sativa Indica Group]
Score 857
Evalue 4.34434e-90
Total Hit Count 79
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18322
TTTTTTTTTTGCAAATCTGCCAATAATATGACCTTCGCTTATCAACAGGTTCATGTCCATCCGATGAGGACTGATACAACAACATCGAGGATCTTCGCGA
GATTCTTTACAATTAGAATAGCGTGCCGCCAACCAAAAGAGGCCGGGCCAGTGCCAGCACCCAGCCAATTGCGCTCGAAACCTAGATAATAAGGTTGACG
CGGAGTTTGTTCTGTCTCGAACTCTCTTCTGGCTCCAGTGGTAAAACTCGGGTGATTTCGCGCCATCGAGCTCAAGTACGCCGTCAACACGCGGTTCGCC
CGTAGCAGATCGAGGCGATGTACAGGTTCTTCGCCCATTTTTCCTTCACGTGGTTACTGGGGAAGGCAGAAGTTCGAAGGGTTTCCTGGGTCTCGTCCAG
TGGCTTCCTCTTTGGTATGCTCAAGATAAAAGCAGCTTGGTCAGGTGTGCCTGCCGATGAAGTTATTCTGTAACCACTCTCCCATCGCCGATGGAGTCCT
TCACTTGGATACAGAAAATCCAACTCTACAACCTGGTCAGAGTAGCCCGCATTCCTTGACATGACAACTCCCCAACGGTTCCCAGCAGTACCCATGGATG
TTACATGAAAACCTTCTTTCCACTTTTTATTAATCCACTTATAAGGAAAAGATTCACTGACTTTGTATGACTGCTGTGTGTACGGAGTTCCTTTGGACAT
CACAACCAATGAGCTTCCATTGGTTGCTCCAGCTATTGCTGTTATATAGAAGTTCTTTTCCCATTGCTCCATAATCCAATCCTTGTGCAGGAAAATTTTG
TGAAAGCTCATACACTTGA
page-top