Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18311  (registered. 2007)
Contig Information
Length 1178 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_028943 [Oryza sativa (japonica cultivar-group)]
Score 441
Evalue 2.12582e-51
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18311
GGGCAACCATTCTGGAGTGGTGCACCTGTGGCACCCCTTCTCTATCCACAGTCAGGTCCTCCTATTTGGAACGGCAGAACTCCAGTGTCGCAAGAGGTGG
ACACGCAAGCAACTTCATCGCAGCAGAGTGATCCCACAGAGATGGACTGTCAGCAGACTGAAAGCACACAGCGACAAGAAGTGCTACCTTCACCGACTGC
AAATGAAAAGCATCTGCACGTTGAAATCCCCTCAGACAGCAACCCTCAGCAGGTTTCACCCATGGCCAGCGAAAGCGGAACCGGAAGTAGTACTGTGTTG
AACAACTCTGGCAATGCTCTCAGTGGAAGTGCCTGTGGAAGCTCTTCCAACCGGATCGCCACCCCTACCGAACAGTGTAACGCATCTGACGGTGCTACTG
AAAATCCAAGCATGGAGGGCTCGCATCAGCTGAGCCAACGAGAGATTGCACTGAACAAGTTTCGGCTCAAGAGGAAAGAAAGGTGCTTCGAGAAGAAGGT
GGGCACAAGAACTAATCTTACCTTTCCATTTCGATCCAATTTTTTTGTGGCATCTCACCTACTAGGAGGAGCTGGGGTTTACATTCTTCCATTATTGCGC
AGGTGCGGTACCAGAGCAGGAAACTACTTGCAGAGCAGCGTCCCCGGGTGAAGGGTCAGTTTGTTCGGCAAGAGCAGAACATCCAAGCAAGCTAGGTATA
TCACCACAGGTGACAACCGTTTGCCGTGCTGCGCCTACTGAGTGGAGATCAACTATCAACCTTTCTTTCTTTCTTGTATCCTATGTATACGCTGACTTGT
CGTAGATTAGCTCGTACATAGTAGAATTTGTCAGTAGGCGGCTAGAGAACACACTGCCTGACTTGGTACATGTTTGCCGTATACGTTGTTGCACTCTGTG
TGGTTGCAAAGGTGTCAGTCAAGGATGTCCTAAGACACTCTTTTGTGTGCTTTCTTGAACTGAGCATCGTTGCTGCAGTTTAGTTCACTGCCTCAGCAAA
ATGCTGTCGTCTTTCCGTACTAGATGGATTTATATTCAAAGGCATTTTGTAATTTTTCGTACATTTTGGCTGAACTTCTGGCCATGTATGGACGATGGCT
GGGCGAGTTCTTGCGTGATTTTTTCTGTGTAATAAATTACCGGCCGCTTGAAGTTTGAAGCACTGTTCAAAAAAAAAA
page-top