Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18170  (registered. 2007)
Contig Information
Length 848 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_V483 Shoot grown under cold condition for 3days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0609400 [Oryza sativa (japonica cultivar-group)] >gi|47496841|dbj|BAD19601.1| putative iron-stress related protein [Oryza sativa Japonica Group] >gi|47497956|dbj|BAD20161.1| putative iron-stress related protein [Oryza sativa Japonica Group] >gi|113536925|dbj|BAF09308.1| Os02g0609400 [Oryza sativa (japonica cultivar-group)] >gi|215692432|dbj|BAG87852.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767709|dbj|BAG99937.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218191143|gb|EEC73570.1| hypothetical protein OsI_08016 [Oryza sativa Indica Group]
Score 661
Evalue 2.48653e-67
Total Hit Count 22
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18170
GGGCGGCAGCCGTGCTGGGCAGGAGGAGGAAGGAAGCAACCCCACCCACCACCCGCTTCTTCTTCCTCCCCTCTCCACGCCTCCCAGGGCCCGAGCTGCT
GCCATGGCGGATAGCAACCCGGACAGCATCAAGAGATACACGCCTCCCGTGCACAGGAATCGTGCAAACAATCGCCGCAAGGCTGGAGATAGGGCTGAGA
AAGCCAACTATTCATACAACAATGATGGAGAGAAGAGCCATGTTCCTTCACTAAAGAACCTTCCTCCAATTATCCATCATGATGCTTTTGTCAGCAATGC
TCAAAATGATTACAGTCATGCAAGATTAGTACCATTGGAAGGATGTTCTGCCAGTGAGGCTTCACAGCTTCTCAGTGAACGTTGGGCTGCTGCAATGAAC
ATGTATAATGACCCAAATGATTCCCCTGATAAACCAGTGATGTACGCTGGATCTGGCGGATCGTCATGGGGTCAAGGTCACATGAAGCTTCCTCATCAGA
TGAACTTCCTCGAAGATCTGCGTCGTGCGGTAGATGCTCAAACGGGCCTGGCAGCGGCGCTCAGCAGCTGGAACTAATTAAAGTCAAGCTGCATCGGTGG
AGCGTCACAGATTTATCAGAAGCAAGCTATTTTGCCAGCTCAATTTGTGTTCAGTTTCGTTTGAAAACTATATGTATGATGAGAAGTCCAAATTTTAGTC
TAACCTGCGGCTGCTTGGTTTCTCTAAAATGGGAGCAGCAGTCAATCTCTTGTAGCCTTACAGATGGAAGGGCATTGCTGTGTCGTGAACCTGAGTCACC
GGGTAGGTACTCGATTACTCTGCCTTCACAATGTCCTGGTAAAAGTGA
page-top