Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18058  (registered. 2007)
Contig Information
Length 593 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_33234 [Oryza sativa Indica Group]
Score 125
Evalue 1.67559e-05
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18058
CACGATCTGATTATTATCTTGCTTAGAGAGGAAGGTAGCTAGCCTGCATCTTTCAGCTGCGCCTGGTCAAACATGGCTTCCATGGGGTTCAGCTATGCGC
AGATACATGTGCGGCAGGAGAAGGTCAGGCAGAGGATCAACCAACAAGAAGCCGCCAACAAGACGGCCGTGAAGAACAAGAACATCGGTGAAGAAGACAA
GATCAACAAGAAAAACTGTGATTCGTGGACCACCGCCGGCAGGGTGCATCCGTGCGCATCTTCCACGGCAGCGGCGGCGGCTACGGCTAGGCCAGTGCCA
GAGAGGTGAGGCTGGCTGGCGATGCGTCTTCTCTTCTCTGAGTAGTTTTAGCTTGTCTCAAGATTTCCTCAAGGAAATAAAGATGTGTGCTCATATATGT
GTTTTTTCCACAAACTTGGGGATATCAATCAACGCCAAACAATCAAATATGCTCCAGCCACAGATCTAAAATTGTTTCTGACAGGCCTGCCTGTCGACTA
ACAAAGAGACTCACTAGAAGATGCAGGAACAGAGTATTTTTTACATGGCCATAGAGCCATGGTATTGGTACTCTCCTATCTTGAGACTGGAAA
page-top