Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18011  (registered. 2007)
Contig Information
Length 1759 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27102 [Oryza sativa Indica Group]
Score 749
Evalue 4.45493e-77
Total Hit Count 168
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18011
TTTTTTTTTTACTGTATGTTCTCTGAAGTTATTGGCAATGTTCTATCAAAATTACCACAATGGAGACAAATCTGGTAACAGTAAATAAAACCACCAAATG
CAGTATGCCCAAGTTGCTTCGCTAACTAATGTGGGACAAGACTTGTATCTTCAGCTGACAATTCCCCGAGGAACAAAAGAAAAACCTGTCTACATAAGCA
TGTCTGTAGATCTTCGTTAGACAATCAGTTAGACAGGCAAAAAAGGGCGGCAGGGCAAAATATTTATTCAAACTGCTGTGCATAACAAAAGCCATCCTTC
AGCTCATTCAGGAAGGAACCAAGAGATTATCACAATGTGATTCGCCCACACACGCGCCAGTATGCTCCAGGGTGGAAAAGGGATCTTTCAAACACCCATA
TGTCTTTCACCAGTACCTCCTTTGACTTGTCCCCTGACACAACCTCTCCTTTTGAATTATAGGCTTCAAACTTCTGCTTAGTGACGAACTCAAGCGTAAG
CTGTATGAAAGCTTTGTCAAGGTCATTCTTATCAAGACCAATCATACGAGCCCTCAAAGTTTTTATGCTTACAGCAGGCTCCACCAATTCCAAGTGTACA
GATTTCCACTTGGATTCTCTTCTCTTTATTTCATTTTTAACAATAGAATGCATCCTGTCCGTCAGAGCTTTCCGGAGAGATGATGTGTCTCCTTGTGCCA
TAAGCTTGTTAACCTCCTTGTATATATTAAACGCTTGATCGTAGAATTGTTTTTTGGTATATCCGGTTTTCTTCCTCAACCTTGACACAGTAAATGCATT
CATGAACTCATGTGTCTTCTATTCACATGAAAATAAGAACTATTGTGACTTGGTTCTCTCAATGTTGGTGCATTGGTGCCAATGCAGTCAAACAACCAAT
GTGCTCCCAGCAATGGAAAGTAACCTCTTAGATTTCTGCAGAATAACATCCTCTTTTGTTCTACTCCAGCCACTTGGTGTAAACAATCTAAGTCACAAAA
TAATAGTTATGAACTTATGATGATGATAAAGATTTTATCATGCACTGGGGAAGTTTGTTATGGGGCATTCAATAAAGGAACTGTGAGTTTGAACCCTTAG
GCATCGATTTTAAATGGCCAGTTCTGGACAACTAACAGATGGATCGGTTTTACGAAGAAAAATCTCCCCACAGCAACCAGAGAGGGCATTGAATACCATA
TACATAATGATCTAAGGCAAATTAATTATAGAGAGTGAACATCTGCACTGGAATTCAATCTTTTCCAAAGTGGGATAGGTTCCGGGGCACGGTATGGCTG
AAAAACAAAACCAGGGCTCGGCATGTCAACTTTCAAAGCAACCTTGCAACCACCAAAAGAAACGCCTTCGGACAGGGATGGTGGTTTTGGGGCTGCTCCT
GCTCCTGCTCCTGACGACATTGGTCTTGCATGATTTAGGTGGACTACAAGCTCTAGAACCTGCGCGGCGTGGACATGCGACGGCCCTCCAAACTTGCCAG
AAATCACGCCGCCGCCATTGTATGTTAAGCTTGCAAAGCCTTCTTACGCATGTGTTCGCGTGGATCGGAGCGAAAGGCCGGGAAACGGTGGCATGGTGAT
CTGGCGGCGGTGGTGGAGGCAGGTGGAGAGGCCGGTGGAGGCGGCGGGCCAGCGACTGGCCGAGGCGGGCCAGAGACATCAGCGGGGTTTCTTCTCCGCG
CCGGCGCCGGCGACGGGGATTGGGGAGGTGCGAGGAGCGGGACGGAAGTGGGCGGCGAG
page-top