Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17975  (registered. 2007)
Contig Information
Length 1524 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_029565 [Oryza sativa (japonica cultivar-group)]
Score 988
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17975
TAAGTGCTCTTAAGGGAGAGAATGTTGATGAGCTATTAGAGACTGTCATGCTTGTTGCTGAGTTGCTAGAATTAAAAGCCAATCCTCATAGAAATGCAAA
GGGTACGGTTATTGAAGCATGTCTTGACAAGGCTAAAGGACCTCTTGCCACCCTAGTTGTACAGAATGGAACCTTGAATAAGGGCGATATTCTTGTTTGT
GGTGAAGCTTTTGGAAAGATCCGTGCAATGTATGATGATCGTGGAAGCCTTGTAGACCAAGCAGCGCCATCCAACGCCGTGCAGATTATTGGCTTGAACA
ATGTACCCCTTGCTGGTGACGAATTTGAGTCTGTTGATGACCTTGATGTTGCACGCGAAAGGGCAAACGCGCGTGCCGATGCAATGAGAATTGAAAGGAT
AAATGCGAAAGCTGGGGAAGGAAAAGTCACTCTGTCATCCATTGCAGCTTCCATTTCATCTGGGAATCAAGTAGGGATTGATACGCATGGGTTAAATGTC
ATACTTAAAGTTGATTTTCAGGGTTCAATTGAGGCCATTAGGCAAGCCATTCAAGCGCTGCCTCAAGAAAATGTCTCTTTGAGATTCCTACTTCAAGCTC
CAGGAGATGTGAGCCTCAGTGATGTTGATCTGGCTGTTGCTTCGGAAGGAATTGTATTTGGTTTTTAATGTCAAAGCTCCGGGGCCAGTTAAGAAATATG
CTAAGCAGAAAAGTGTGGAGATTCGATTGTACAAAGTGATCTATGATTTGATAGATGATTTACGCAATGCCATGGAAGGGCTTCTTGACCTTGCTGAGGA
GGAGGTACCACTCGGTTCAGCCAAAGTTCGAGCTGTTTTCAGTAGTGGCAGTGGAAAGGCAGCGGGTTGCATGGTTACTACAGGGAAAGTTGTGGAAGGC
TGCAATGTTCGGGTTCTTCGTAAAGGAAAAGAAGTTTATGTGGGTACACTTGATTCCTTGAGACGGGTGAAAGAAACTGTGAAGGAGGTTGGTGCGGGGC
TAGAATGTGGTATTGGGGTAGATGACTTCGACGATTGGGAGGAAGGTGACGTCCTTGAGGCATTCAACACCGTGAAGAAGGCAAGAACGCTTGAGGAAGC
CTCTGCGACTGTGACTGCTGCTCTCAAGGGTGCAGGCGTCCAGGTGTAGATGTTGCAAAGCTGATAAGCGAGTAACAACTGCAGCAGCCATTTTTTCTTT
TGGCGTCGAAGCTGGAGTGCGTTGGCCACATTCCCTAAGAATGACACTCAGGTACTTGAAAGACAGAACCTATACATGCCACATGACGTGCCTGCGTTGC
TGCCGGGAGCCTGCCTGTGCTGGACCGTATTGTATCCCGCCTCTCAAAGCTGCATGTGCTACTGTATGTTGATGTACATAGAGAAGATTACATCTGCTGT
TTTTAGTTTGCCTCTAACAGGTAGATAAAGGGTGTGTGTGTGTTTCTAGTTTTATGCCTTTTGACTTCTTGAGACAAGCTGTAACCTGCAACGTTGAAGC
CGCATCATTTTCCGAAAAAAAAAA
page-top