Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17899  (registered. 2007)
Contig Information
Length 1322 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19972 [Oryza sativa Indica Group]
Score 1704
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17899
TTTTTTTTTTTGAAAGAGGGACGCAATATCATTGAAACATCCCCTTGCATCACAGAACATCCTGAATCAGTACATTTGTCCGGGCTTCATTGCCCAGAAC
GGTGAAAAAAAGGATGCCTCGGACTGATGTTTATTCCTGTATGAATGGTATTTACCCCCATTATGAATGTCCTACTGCCTTACACAGGATCCTGGTTCCG
ACGGAGCTGTGCGGCCATATCCAGCCAGCGGCGCTGCAGCGACCCCTCTCTCATTCAGCAAGCACCTGAAGTGTGCCAATCTTGCAGTGACCGCCGTTGT
GTCCTTCGCGAGCTTCTCAACGGGAGTCCATAGCCGCTCTGCAGCTGCTGCAGCACGAGGCCAAATGGTTTGTTGAATGTCAGATGCATCTATGTGTTCT
CCCCACATGCATACTTCTCCGCCAAGAATCAACTTCTGTTGCTCTGGGTTGTAGATATTTGTCAATGGTTCATTCATATAGAATCCTTCCCATGTAGCAT
CCAGGTGATCTAGGTACCACTTATCCTGGTTGCTGACAATGCATCTCAGACCAGCAGAAACCACTTTCTCTGCAACTCCACCTCCAAGCCAGTTATGCAC
CACCGTTTTGCGGTCCAACTTGTCTCCAAAGTTGTTAAACGTTTCTTCCCAGTTAATAATCTCGTAGCCATGTGAAATTGCAATCTTTTGAGCCTTTAGG
ACAAAATATCTGTAGGCATCAGACTCATTCATACCATGTTGAACCAACCATGATTTAATGCGTGGTGTGGTAGTCCAGCAACTTGTATCGACTTCATCAC
CTCCCAAATGGACAAACTTGAACTTAAAAACCTTGCTAAAATCTGAAAGAATTCCGTCGATCACTTTAAATGTAAAGTCGTTGCTGACATCAAGTGGTTG
TTGGCAGGTAGCTGATGGCCACAACGATGGATATCCAACACCCCATGAACCAGCATGGCCAGGGACATCAATCTCAGCCAAGACATTCACACCTCTTTTT
TCAGCATATTGTACAATGTCGATCGCATCATTGATTGTATATTTTTCTGAATAAGAGTATGCACCATTTGATAATTTTGGGTATGAAGGTATTTCAAGAG
GAAATGGCTGCTCATCCACGATGTGCCAATGAAGAACATTCAACTTACTGTAGACCATTGAATCGATTACACTTTTGATTACCGGGACAGGAAGATAATG
CCTTGCGGTATCAATAAGCAGCCCTCGATAAGGAAATCTTGGCTTATCCACGATAGTCCAAGGAGCCCAATGTAGTCCAGTTACACTCAAAACAAAATCG
AAGTAACACAATTGACTGAATG
page-top