Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17801  (registered. 2007)
Contig Information
Length 970 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit zeaxanthin epoxidase [Triticum aestivum]
Score 962
Evalue 1.07091e-124
Total Hit Count 230
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17801
ATGAACACGTGTTAATAGGCACAACAATGTACTGTACTAGGTACAATATTACAGTGGCAACAGCTAAAAATTGCCTACCCTATTGTACACCCTCGGTTCT
TTTTCGTAGAACTGCAACGTAGTAATTCTGTCAGAAGCTACTCAAAATCCTGCTTTGGATATCTGGATGAGTGCAAAAGTTACAATTCTTTTTCTTTCCA
TGATGCAGTGTCGGCTGTTTACTGAAGAATGCTGTACAGTGGCTGGTGACAAGGGGTCGTTGAAGTCCCCACTCATGCTGCCTGCAGAACTTCTCCCCCT
CCTCTCGCGGAGTCGTACGGAAGCGTGCTCAGCACCTTCACCCGGAACATGGCCTTCTTGTCTGAGCCAAATTCGATGGCATCGGAAGGGTGGAAACGAA
CTGGGAAGTTTGGAGGTAACCGGTAGCGTCTGCCTTCGTTGTCGTTAAACCATGTACCGTGCTCGCTTCCCAGATCGGTCAAATAGAAACCCTTATTCTT
GCATGTGATAGTAGCATGGATCTCTGATACTTGTGGCAAGGGGAACGACAACGAAGAATCAGAATTGCTCGGATCTGGTTTGCTTCCAATAGAGAGTGTC
CTCTGTTCATCCCTGATCAAACGAATGGGCTGCAAGGCAGAGTCGCCTCCAGAGCTCATAGGGAAGAGGTACCACTCTCCACCCATAGCTTGTTCCAATG
CATCGTCATCCTGAAACCATCGACCAAGCTGGTTGCTTGCCTTGTCAGAAAGCCGGCAACTTAACGGTCTTCCTTCCAGCTTTGAGCTGTTGCCACCTAA
AATCCAGCTCAGCATCAAAGGCATTCCAACCCTTGATGAAAAATCTGCCGCCAACTCTTCCAGGATGCGGTATCCTCAACTTTGTCAAAAACGACAAAGG
TCCCAGACCCACACCTAGATATGGTCTGTAAGTGGTAGCCATGATTGCCGCCATTCTTGCCAATCCATGT
page-top