Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17723  (registered. 2007)
Contig Information
Length 1760 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0598900 [Oryza sativa (japonica cultivar-group)] >gi|33354184|dbj|BAC81165.1| putative cobW protein [Oryza sativa Japonica Group] >gi|113611721|dbj|BAF22099.1| Os07g0598900 [Oryza sativa (japonica cultivar-group)] >gi|125600967|gb|EAZ40543.1| hypothetical protein OsJ_024026 [Oryza sativa (japonica cultivar-group)] >gi|215734925|dbj|BAG95647.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1095
Evalue 3.4046e-166
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17723
AAGGCGAAGCTCTCGAGCTCTCGGCGGCTATGGAGGACGACGACGAGTGCCCTCCCCTCGCCGTCGAGCTCCCTCCGCAGACGACCTCTCCTCTGGTCCC
CGCTTCCGCCCCCGCCTCCGCCTCCGCGCCGGTCGGCGTCACCGTCATCACCGGCTACCTCGGCGCCGGCAAGTCCACGTTAGTCAACTACATTTTGAGT
GGACAACATGGGAAAAGAATAGCGGTAATACTGAATGAGTTCGGAGAGGAAATTGGAGTAGAAAGAGCAATGATCAATGAGGGGCAAGGTGGTGCCATTG
TTGAGGAATGGGTGGAGCTAGCAAATGGATGCGTTTGTTGCACTGTAAAACACAGCCTGGTTCAAGCACTTGAGCAACTTGTGCAGACTAAGGAGAGACT
TGCTACATCTGCTGCAGAATGGATCATATATTATTGGAGACAACTGGTTTGGCTGATCCTGCACCACTTGTATCCATTCTCTGGCTGGACGATCAATTGG
AGTCATCAATCAGACTAGACTCTATCATTACGGTTATTGATGCAAAAAACTTCAGGCGGCAAATTGATGAACACACGAACTCTTCGTCATTTCCTGAAGC
ATTTCACCAAATCGCATTTGCGGATGTTGTGATATTAAACAAAATTGATTTAGTAAAAGACAATCTCGAGGATTTGGAAAGGCAAATTCATGATGTCAAT
GCGCTTGTTACAGTGGTGCGGTCTGTGCGGTGCCAGGTTGACTTAAATACAATATTTGATCGACAGGCATATGGTGTGAAGAATTCATCACAACTACAGG
AGCTTCTGGAGTACAGTAAATCAGCACCACCTAATAGTCGCCATGATAACAGTATTTCCACTTTGTGCATTTATGAACAGGATCCAGTTTGCTTGACTAA
GGTGGAATCATGGCTTGAAGATCTTCTTTGGGAGAAGAAATCCAACATGGATATATATCGTTGCAAAGGGATTTTGAATATCCATGATTCAAACCAACTT
CATACATTACAGGCAGTGAGGGAAGTCTATGAGGTTGTGCCGGCTCGAGAATGGTCGGAGACACAATCTCGCATGAACAAGATAGTTTTCATAGGCCGTG
ATTTGGATATCAGTACCCTTCAAGATTCATTTAGTCGCTGCAAGCACTGATTATCGAATGATTTGCACCCACCTTGTACCTGTGTCATTGAATACTTGAT
GGAGGCTCACGCTGCCTGGATTGAGATTAGGGTGTTCTCGTATGGTTCCCCGAAGCTACATTCTGTTGAACAATCTTCAGTAGAGGCGAAGCAGTTTGCA
GTGCCGAGATCAAGAGACGACTTCAACTGCTGCTATGAAGTTATGTGCCACGGGAGCACCTCCCTGATACACTAGAAAGGCATTACGCTGAGCATTTGTA
TATGTTCAGTATAGCAAATGCAACTGTGTTAGGTTTTGCAGAGGGAAAATGTATCCAGTCGTAAGAGGATGTGATATCCAAATATGGTGCAGAAAGACCT
AAGTCGGCCAACACCATAATCTCAACGGAAGATGCCTCTGGAACTTTTTGGTTCTTTTTTGGGGGCGATACGGAAGCAGCTAGGTCCCTTTCCCCATGGA
AGGATTTTGGTTCTAGTGACATCCAAGCTGATGGTTGCGTGCATCGGTTGATGCAGACAGGGGCATACTGGAGTGGAGACCTTACTTGAGCCGTAGCTTG
CTTCCATAATCCATCGCCTCTTGGTGCTGCTAGTCACCTTGTAACTGCAATTTCGAGCTT
page-top