Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17617  (registered. 2007)
Contig Information
Length 932 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative acyl transferase 4 [Triticum aestivum]
Score 1364
Evalue 8.87873e-149
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17617
AATACAGCAACATTAGCAACAATATATCAACCAAACAGACGCATCAGCAGAGCTCCACGATGCTTCCATCCCCATCCCCCTGCATGCATGCATGCCAAGG
TTTTCTCGGTCTAGCAAAGCAAAGCGAAGCAGCTCGCTCAGGGCAGGTCCTCCTTCATGCCGCGGGCGAACTCCTGGGAGTGCTCCTTGGTGACGCAGCT
GGCGAGCATCCTGGCGCCGTCCAGCGGCAGCGGCGCCTTGAGGATGACGACGGAGGCGATGAAGTCGTTGTTCACGAGCGGGCCGGCGAACATGGGCGGG
CCGAAGCCGTAGTCCACGTCGGAGAACCCCAGCTTGCTCCAGTCGGAGACGTAGATGGACTCGTAGTCGAAGCTCATCTGGAAGGGGTCCTGCCGCGTCT
CCTCCTTGGCGAACTGGAAGAACTCCACCGCCATCCGCTGCTTCGCCTCCCGGATCATGTCGATCACCTCCATCACCGACGACTCCAGCACCTTCTTGCT
GCTCCCGGACATCTTCACGGGGAAGATGGAGTTGCCGTAGTACCCCGCGTCCAGCTTCAGCAGGTGGCGCACGCTGGCGAAGAAGCAGAGCTTCACCGTC
GCCTCGGGCTCCAGGTTCAGCGCCCGGGTGCGGCACTGCCACAGCTTGGCCGTCAGCACGTCGAAGCCGGAGCAGAACTTGCCGCTGTGCGCCTTGTACT
GCGTTTTGAGCGCGTCGATGTAGCCCGTGGGGAAGTCGAGCACGATGTAGTCCAGCGCCAGCACGGGGAGCTCCGGGAGCGGCCCCGGCTTGATGCTCGG
GTTGGGGAACTTCTCCCTGTCCCACACCGGCTTCACCGCCGGCTCCGGGAGCCCCCGCGCCATGTCGCCCACGGCCTTGATGAACTGCGCCGCGCCCATG
CCGTCCGCCGACGCGTGGTTGAACCGCAGGCC
page-top