Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17547  (registered. 2007)
Contig Information
Length 1028 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0580200 [Oryza sativa (japonica cultivar-group)] >gi|12039377|gb|AAG46163.1|AC018727_15 putative ADP-ribosylation factor [Oryza sativa] >gi|110289663|gb|ABB48042.2| ADP-ribosylation factor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113640043|dbj|BAF27348.1| Os10g0580200 [Oryza sativa (japonica cultivar-group)] >gi|125575825|gb|EAZ17109.1| hypothetical protein OsJ_031318 [Oryza sativa (japonica cultivar-group)] >gi|215687233|dbj|BAG91798.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697085|dbj|BAG91079.1| unnamed protein product [Oryza sativa Japonica Group]
Score 972
Evalue 2.93462e-103
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17547
TTTTTTTTTTAGAGTAAATACTGTGATTTCTTCAGACTAAACCACAAATATGAGCGTGTCATGCCATCGGTAGAAACATCAGTATTTACATCCCACAATC
CTAGAGTAGAACAGAATAGATATGCGCTTCTAACTAGGAGGAGCACCCCCTCTTCAGAAATGCATCTCCTCTTGCGGATCATTCATACTACAACAAATCT
GTCGACCACATCAAAGGGCAGCCACAGGGCAGACACAAAAAGGAAAAATGAGGTGCCAAGAAACACAGACGAGCCATCCCTGTTACTCTTTACGCCGATG
TCGAAGCTAACCGCCCTGTAGCTCGCATTTCATCCAGAGTCGTCGCTAGCCAGTCCAAGCCTTCGTACAGGCCATCGCCTTTAAGAGCACATGTGCCTTG
GATGTGCCAGATGCGGTTGTTCAGGTCATACAGACCAAGACCCTCACATACTTCCATCGGGGTCATTGCTCCCCTCATGTCTTGCTTGTTAGCAAACACC
AATAATACACTGTTGAGCATAAATGGGTCATTGATTATGGCCTGAAATTCAGCCCTGGCTCTTCCAATTCTATCCCTGTCGAGGGAATCGACCACATAGA
TCAGAGCATCCGTGTTGTTGAAGTAGTGCCTCCACAAGGGCCTCAATTTCTCCTGGCCGCCCACATCCCACACAGTGAACACTACATTCTTGTACTGAAC
CTTCTCAACATTGAAACCAATGGTGGGGACGGTGGAGAGTACTTCGCCAATGTGTAGCTTGTAGAGTATGGTGGTTTTACCGGCTGCATCCAACCCAAGC
ATCACCACCCGCATCTCCTTGTTGCCAAAGAAGGCATCGAAGAGCTTGCGAAAGGCCTGGGCCCATCTCCCTCCCTCCTTGGGATCAGGAGAATCTGGCC
GGCTGGTCGGCCGCCGAAGAGGATGGGAATGGACCGGCTTCTGGAAGTTTCTGCTGCGTGTGTGAGGTTCGGGGTAGGATCGATCGGCCCCGCCCCTGCC
TGCCTGCCTTGCTTCCTCTGGTCGAAGC
page-top