Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17545  (registered. 2007)
Contig Information
Length 1141 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0435100 [Oryza sativa (japonica cultivar-group)] >gi|17297985|dbj|BAB78490.1| 26S proteasome regulatory particle non-ATPase subunit12 [Oryza sativa Japonica Group] >gi|34394724|dbj|BAC84087.1| 26S proteasome regulatory particle non-ATPase subunit12 [Oryza sativa Japonica Group] >gi|113611036|dbj|BAF21414.1| Os07g0435100 [Oryza sativa (japonica cultivar-group)] >gi|215692472|dbj|BAG87892.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692486|dbj|BAG87906.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215715252|dbj|BAG95003.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1165
Evalue 1.43738e-125
Total Hit Count 202
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17545
ACTTGGAGCCTTGGAGGAGACTCGAACCCTAATCCCCTCCCGCCTCGATCTCTCCCGCCGAAGGAGAGATCCCGTTCAGCCTCGGCTCCAATCCGCGACT
CGACTCGACTCGAAGCTCCAGCTCCGCCGCCGCCCCCCGCCGCCGCCGATGGATCCGAAGCTGGTGGAGGTGACGCAGCTGTTCGACCGCTTCAAGGCGG
CCTTCAAGGCCAGCAATTTCGACGTCTGCTCGACCCTCCTCTCGCAGCTCAAGGTCCTCCTCACCAAGTTCCCCAGCCTTCCCCCGCTGTTCCAGCAGAC
GCCCAACGCCGTGGAGGAGCTCAAGCTTGCGAGGGAAATTTATGAGCAGGCAGTTATTTTGAGTGTGAAAATGGAAGACCAAGATGCATTTGAAAGGGAC
TTCTGCCAGCTCAAGCCCTATTACATGGACACATGCGGCATAATTCCTCCATCATCGGAGGAGTACCCAATCATGGGGGCTAACCTTCTGAGGCTGTTAG
TCCAGAATAGAATTGCGGAGTTCCACACTGAGCTGGAGCTTCTTCCCGCCAAAGCGCTGGATAATGCTTACATCAAGCACGGGGTTGAGCTCGAGCAGTC
CTTTATGGAGGGCGCATACAACCGCGTGCTGAGCGCTCGACAAACCGCGCCGCATGAAACCTACATATACTTCATGGACCTTCTCGTCAAAACGGTTAGA
GACGAGATAGCTGGGTGCAGCGAGAAGGGATATGATTACCTGTCAATAAACGACGCGAAGCAGATGTTTAAGTTCAGCTCCGACAAGGAACTGCAACAGT
ACATCGCAGAGGAGCACCCCGAGTGGGATGTCAAGGACGGCCGGGTCTTGTTCCAGAAGGCGAAGGAGTCCCAGCCCTGCAAGGAGATCCCGGCAGCGCC
GGTCATCAACCAGACCCTCGGCTACGCGAGGGAATTGGAGAGGATTGTGTGATTTGTTTGCCTCTTTTTTCTTCATCATTGGACTGAGTTTCCCATGAAG
AGGTGGATTATTGGATTGGATTGCCCTGTGACTCGGCTGTACTATTTTGTTAAATCGTTTGTTTCACCTACGGTTTCCAAAGCTACACAACTGTGAAATG
TCGGCCTAAAATGGCAGAAGAAACAATGCCTGTTATGTTAA
page-top