Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17544  (registered. 2007)
Contig Information
Length 1275 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MADS-box protein [Triticum aestivum]
Score 1291
Evalue 4.12758e-140
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17544
AAGTTTGGGTGAAGGCTACAACAATCAGTAGCCTCCTTACACAAAGACCGCGACCAAAAATCACCACACATGCTTGCTTTTTATTAAGCGCCCACGAGGT
CACACACTTGACTCACGAACTAAACTCAATTCATCCCTAATAATAATCCCCACCCCCTTATCTTCCTCCCCTCCTCTCCCTTGTTGCTACGAGTAGTACG
CTTGGTGGTGGTGGTGGTGTGTGTGTATGGTTGCTGCAGCATAGCTAGCTAGGGACGGGGAAGGTGGAGGAAGCAGCGGAGTCAGCCATGGGGAGGGGGA
GGGTGGAGCTGAAGCGGATCGAGAACAAGATCAACCGCCAGGTCACCTTCGCCAAGCGCAGGAACGGCCTGCTCAAGAAGGCCTACGAGCTCTCCGTGCT
GTGCGACGCCGAGGTCGCGCTCATCGTCTTCTCCAACCGCGGCAAGCTCTACGAGTTCTGCAGCACCCAGAGCATGACGAAGACACTCGACAAGTATCAA
AAATGCAGTTATGCAGGACCTGAAACTACTGTGCAGAACAGAGAAAATGAGCAACTGAAAAACAGCCGCAATGAGTACCTGAAACTAAAGGCACGGGTTG
ATAATTTACAGCGAACACAAAGGAATTTGCTTGGTGAAGATCTTGATTCCTTAGGCATAAAAGAGCTCGAGAGCCTTGAGAAGCAACTCGATTCGTCCTT
GAAGCACATTCGAACAACAAGGACACAACATATGGTTGACCAATTGACAGAACTCCAGAGAAGGGAACAAATGTTTTCAGAGGCGAATAAATGTCTTCGA
ATAAAATTGGAGGAGAGCAACCAGGTTCATGGGCAGCAGCTCTGGGAGCACAACAACAATGTACTGAGCTATGAACGTCAGCCGGAAGTGCAGCCGCCGA
TGCACGGCGGCAATGGATTCTTCCACCCCCTTGATGCAGCTGGTGAACCCACACTTCACATAGGGTACCCTCCTGAGTCCCTGAATAGCTCATGCATGAC
TACTTTCATGCCCCCATGGTTGCCTTGATTGAAGACGGCGAAGAAAGTGTGAAAAATAAGTATATACGCGGGCACCCAGCCGGCCGCATATATGCATGTA
TTCTACTTCGAGTGATGGATTATTCCAGTCAAGATCCTCAGTTATTTTGCATGCAACTTTTGTGTCATGAAAACTTCAGAACCCTGTATTTGATGCTCAA
GATTATTGTGTTACTTGCGTGTAAAAGAACATACATTATATTACTAGAGTGGCTATGCGTGATAATTTTCCCCTA
page-top