Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17527  (registered. 2007)
Contig Information
Length 1493 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24967 [Oryza sativa Indica Group]
Score 1453
Evalue 8.43584e-159
Total Hit Count 50
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17527
CATATAGGGAGGAAGCTTTATTCTGTAACAACCAAGGTTTCAGACACAGCATAACAAATTGCTTGAAGGACAACCAGAATATAATTGTTTCTGTGTAATA
CGAGTATATATTAGCATCAGATTACAGATGCATAGACTGACGACACACCATGACATGGTACTATAGCACCTTATTCCACTTGTCTCATCCCAGAAAACAT
CACAAACAGCTCTGCTTTCTAGGAACAGGCAAGGCAATTACATACACGATAAATAGAAATCGGTACCTGGCCGCTAAGTTCCGCGGTTAGAAGCACATGC
TAGGGGTAGGTGCAGGAGCGCCTGCGTTAGCAGAGCCAGGCATCTTCAGCGCAAGAGGATCCCACGCCTTGCCCTCGGCGTCGCTGCAGCTGCCGCTCTT
ATCTGGATACATGACAGTGACTGCGGTGGTGGGGCCGGCAGTGCCCTTTGCAGCCAGAGTCTTCAGGCGGATGCGCTCAGCCCTCGACCCGATGGTCTGC
CCGAGGATGGAGGCTGCTATGGTGAACACCATCGCGGTCCTGGGCATGTTGACAGACTTCCTCAGCATCGCGATGAACGGAACGGCGGCGTGCACGGCAG
CGAACCACTGGGGAGAGAATTTCTTGGTGTGCTCGCGCCACACCCCTAGAGGGACGTTCGCTGCCATCCCGAGCATTGCGATGGCTACCATCTTTGCAGG
CAGGGGCTGCGGACGGAGGGACTTCACGAGGGTTGTGCGTGCAAGGGCCGCTCGTGCAGCAACAATTGCAGGCGGGCACTTCAGCTTCATACCAGCTGGT
GGCTGTAGTGCCTTGGCAACAAGGGGCAGAACACCACTCATTGCCCGGTAAGACCGAGCTAGTGGGCACTGTCCATTTTCTAGCCATTCATCACTCATTG
CCTCGTGGGACGGTGGGTTGCCTCCTTTTTGTTTCATGGAATTCTGATCTGGCTTGTTGGGCTTCTTCTGTGACTGGTCGAGATTGTTGGGCTTCTTGTT
CTGCTTTTTGCCCTTGCCATTAAAGAAGTTAAACCCGAATGGTCCAAATGCTGATAGGCTTATGGTAGCGGCTCTAGCAGCCAATGGATTAAAGGGCAGA
GCAGGTTCAGGCTTGACATCAGTGCTCTCACTGCGGTTCTCATCAGGCACATATGATCTTCCTGAAAGGGGAACTATCCCATCCTGTCCATGAAAAAGCT
TGAATGCCGACTCAAAGCCTGGTCCATCCTCAAAGATCGGACCTTTGCCTCCTCGGGCAGCTACAGGCAAAGCAGAAGAAAATGAAAAGGTTGTAGCTCC
ATTGATGTTCCTCAGGAATGGGCATCTCTCAACACCGGGATGACCAGAAAAGTTCTCCGATGATGCTGAATCACAGAAAAGGCTGCTGAAGAGCATTTCC
ATCCTCGCCGAGTCGCTGAAGAGCTGCTCGCCTGCGTGCTTGGCTCCGTCCGTGCGGTGGGGGGAGAGAGGAGTCGTGTGGTGGGCACAGCGC
page-top