Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17507  (registered. 2007)
Contig Information
Length 844 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00169 [Oryza sativa Indica Group]
Score 119
Evalue 0.000173068
Total Hit Count 29
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17507
CTCGACAAACAACAGCATAGTCTGGAACATATACGCCAACAAAGAGCAACACATTATGCATGGAGTACTGTGACTCTCAAAACATCAAACATGACTGAGA
AACAGTGCAAGGTTTCAATTCGAAAATTTAGGTGCGCAACAAGCAAATTCAAGTAACCGTGCTCCCAGATATCAGTGGCAGACTTCCATTGTGCATGAAG
CTCCAAGACATGGAAGTAGGACGGCAAAAATCTCAGACAGCGGGCAGAGCACAGCGCATTTCAGGCCAGGCAGCTTCAGCGCCTCCAGCCGGTGGACGAG
GAGGTGGATGAGGAATTTGCAGAGGTCCTAGATCCAGGACGCCAGCGTTCAGTAGATGCAGCTGGAGCAGCACCGTCCGGCTGGCGGGCAGCAGGGGGCG
CCTCTTGGCGTGCGGCGGGAGGAGCCTCCTGGCGGAAGGGACGCGCATCACGTGCAGGAGGAGCTTCTTGGCGGATGGGACGAGCATCGCGCACAGGAGG
AGCATCCTGGCGGAGGGCAGGGCGAGGACGATCATCCCGGACCCACCGGTCTGGTTCAGCTGCCGCAGTCGGCCTCTGACTGCTACTATCACCCTCACGT
TTCCACTTTGGGACATACTTGCTAGGAGCAGCACCAGTTGCTGCAGCTGCTGCAGCTGGGGCTGCCGCTGCTGGTTCACGGGCTGGCGGTGCGACAGCAG
CAGCAGCTGGTGCATCAGCTGCGCGCACGGGCTCTGCTCCTCTTAGGAGAGCCTCCCTTCTCTGTTTCTCCCTCTCTTCTAACTCCCTCTCCCTCTGCAG
CTGCTTAGCAGCGATTGCGTCAAGTTTGAGCTTCCTCACGGCTT
page-top