Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17456  (registered. 2007)
Contig Information
Length 1317 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0511000 [Oryza sativa (japonica cultivar-group)] >gi|48475070|gb|AAT44139.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579564|dbj|BAF17927.1| Os05g0511000 [Oryza sativa (japonica cultivar-group)] >gi|215692661|dbj|BAG88081.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215695037|dbj|BAG90228.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737412|dbj|BAG96542.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1091
Evalue 6.74872e-117
Total Hit Count 303
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17456
TTTTACTGCAATAGGTAATGCAGCCGTAACCAAACATATATACAAATCGAGCATCTAGGAAAGGCTGGGTAGTCAAACACCGAAACGTGGCAGCCGAGCT
GAAATCACCGATATGAGCTACGGTCGTGACTACTACTCAGAAGCTATAAGCAGATGTAACCAAATCTACAGATGATCGGGCGGTAGTTGTACGTTAAATC
ATGAATACTCATTCCACTACTCAGCATGCCTCTTGGCCATCGTCTTCTTGAGACCTTTTAGGATCTTGGAGAACCAAAGCACATTCATCACGAAGATTAT
GCAAGGCGCAATAAGTACCAGAAAATAGCCGAAGGTGTTCATCTTCTTAATCTGATCATAATGTACAAACATGTGATAGAACAAGTACATGAACAGAATT
ATCCTTGCAACCAGCCAAGTAACAACCATTGCAACTCCGTTAACAAGGTAAGCTTTGGAGTTCGTCATTCCAGCAACATCAAGGAACCATCTTAGATTGA
TTCCTGGTGTAGTAGTCTCAGTGATGAGACCCATGTATATGTATACATGTGCTTCCCCAGAAAGCATAGCGTACATTGTAGACATAAGTGAAAGCATGTG
GTGGATAACATACTCCATTCCACCAAGGGCAGGGTAAAGCCAATATATCATGGCAATGTCTGTAATGAAATACCCAATAGAGACCCCTAATGTAAAACTG
GAGAGGCTTGAACTTCTAACTGTTACTGGTCCATCCAGCTGGTCAGAAAACATGCCCGAGAAGAACACTAGGTATACTGACATAACTGTAATGAATATTG
CATGGACAGTGGACATGCCCCTGTTGTTCCATTCGATCTTCTGCATATCGTTAAGAGAAGCATAACCTTTGAAGTTAAATGAACTGATAATGCGCGTGAA
ATCGTAGGCCAATTTGCACATCAGGATCCCCCCGAGCACAGCAGCGTATGGAGCATACGAGTCTGCCAGCAAGTAGTCCCTAACAAGAACCTCTTTGTAC
TTGTAGGCTTTAAATGCCATGGCTGGAGCCGCAGGCACATCCATATCGAGATTTCTGGCCACTCAACAGCCTGAGGGGAGCGGAGGAGCTTGCGGTCGCC
GAGAAGGCTGCCTGGCTGGGGTTGGGGTGTTGGCCGGAGGGGAAGCGATGGTGGTATTCCGTCCTCTTGCTTGTGTCCCGGTTCTTGCTTGGCTATTGGA
GGGGAGGGGAAGGGTGGGGTGGGGTGGGGTGGGAGCGAGGAGAAAGCGCTGGACTGGATGGAAGGAGGAATCCGCAGACGAGACGATGCCCACGGGCCAC
GGCGGGCGAGAGAAAAT
page-top