Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17442  (registered. 2007)
Contig Information
Length 860 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0262500 [Oryza sativa (japonica cultivar-group)] >gi|37806340|dbj|BAC99853.1| putative cytochrome P450 [Oryza sativa Japonica Group] >gi|113623363|dbj|BAF23308.1| Os08g0262500 [Oryza sativa (japonica cultivar-group)] >gi|215686401|dbj|BAG87662.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737446|dbj|BAG96576.1| unnamed protein product [Oryza sativa Japonica Group]
Score 700
Evalue 7.66992e-72
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17442
TTTTTCGTTTCGATAATCTTACATTATTATCACGATGTTCCGGTATTTTTTATACATGATTTCTGAGAACATTTGCGCCATCCAAGCCATAGCTGATTTC
TCAGGCAATTATTCATAAAAAAAATCCACCCATTGCCGTGAATAAAGTTGTCCGACTTGAAAGCGAAAATATGTATATGGACACACACATACACTACACA
CGCATTCTAAGACAATCGTGGCACACATGCTGGGAAATCCCAAACCCCGGTCAACAAAAGAAAGTTTGTGCTACGCTTCTCGTTTCTTCAGCTTCATCAT
GAGCCCATTTTTCATCTGCAGTAAACAAGATAGCTTGGGTTGGATGCTCTGGCCTTCCACCAGCTCCAGGTCAAAGTTCCACACGACTGCGGCGATGATG
GTCTTCATCTGCACAACTGCGATTTCCTTGCCTGGGCACATCCTTGGGCCTGAGTTGAAGGCCAAGAACTTGTTAGACGGCACATACTTGAGCTTGTTGC
TATCCCCCAGGAGCCATCTGTCTGGGTTAAAGTCGAGGCAGTCTTTACCCCACAAGCTCTCCATTCTTCCCATGGAGTAGAGAGAGATGTAGATGGCATC
ACCGGCATACACCTCATGGCCACTTGGCATGGTATCATCGGCAACCACCGTCTTGCGCTCCATATGCGCTGGTGGGTATAGCCTGAGAGTCTCGTACAAG
GTGGCTCTTAGATAGACCAGAGATTTGGTCTCCTCCGGCTCAAAGATGACCGTGGCACCCATGCCGCGGGCTACTTTGTGCGATAGAATAGGTGAGAGTT
CATTGCGGATGATTGACACAACGTTAGGGTTCTGGGCGAGGCTGTANAATATCCATGGCA
page-top