Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17430  (registered. 2007)
Contig Information
Length 1126 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ligA [Zea mays]
Score 651
Evalue 7.303e-79
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17430
ATGTTGTTGATTTCTGGAATACGTTCAGTAAGCAGGATGGTTTACTTGATTTTAGTAGTCTACTAGTAGTAATTGATGCTCAATTGTCACTGTATATGTA
TGTAGTTACATGGATTGCATCAATGACGGATGTAGGTAATCATAAGGCGCGCAACATACTCCAGTTTGTGTGTCTGTGTGTGATGAATCAGCAAGATTCA
CAGGTTCACAGGAGACGTAGTGCTATGTTTTCCTGCTATTCAATCTCCCCTGTTCTGTTTTGATCGATTCCAAATCCCTATTACATAGATTCCCCGGGAT
CGATCGATGAGCTATATATGCACATATATCCATTAGACTCTACCATTCTATGCATGCATCGGAGTATATGAAGCCCCAAAAGGAGGGAATAATAATAATA
ACTAAGCTAAACCAGCGCCAGCCTTCTTCGGGCTGTCGTCGTCGAGCTCCACATCTCCGGCGCCGGCATCGTCGGACTTCTTGAACCTGTACCACCGTGC
GCAGATCACAAAGTAGACGAGGTTCACGGCGGCGATGGCGGCGGTGACCAGGTAGAATAGGTCCACCCTACCCTCGTCCAGGTCCTGCGCCAGCCAGTCA
GGCTGACCGTCCCACCCGCGCGTCGCCCGGTGCACCACCATCACCATCAGCCCGCTTGCGTAGCTCGCCATGGCGAACCCCAGGAAGTAGAGCGCCCCCG
CCACGCTCCGCATGTTCTCCGGGAACTGCCGGTAGTAGAATTCAATCTGCCCGATGGCGCCGAACGCCTCTGACAAGCCCGCCAACAGCTGCTGCGGCAC
CAGCCAGAAGCATGACATCGACGAGCCGATCCTTCGTCGTCGCTGCTCCACGGCCGCCGACACCACCATCGTCGCCACGGACAACGCCAACCCGACACCG
ATCCGCTGGAGCAGGGTGATGCCGCCCTCGCGCTTCGTGAAGCGGCGGAGCGTCGGCACCACGAACCGGTCGTAGATCAGGGATCCACGTCGTGAGGGCG
AGCATCTGGAAGACGACGAAGGAGCCCTGCGGGATCTGGAAGCTGCTGGACTTGCTGATCCGGCGGTCCATCTGCGCGGCCTGGAGCACGACGTAGGTGC
CCAGCTGGGTGAGCACGATGAAGTAG
page-top