Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17385  (registered. 2007)
Contig Information
Length 1250 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_VABA Shoot with ABA treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09029 [Oryza sativa Indica Group]
Score 1320
Evalue 1.74033e-143
Total Hit Count 332
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17385
TCTTTGGTATAACAAGTTACAGAATATTCAGCTAAATTTTGAGCAGGTTCTCATCAGCTCTTAATCTCCTATCAGCAACTTGGTGTACAACCGGCTTGTT
TGAGCACTGATTGCAGAGGGGGAAAGGCAGCAATGGAACTCTGTTTAACTATTGTGCTTCGCTCAACACCCTCAACTAATTATTTCCCCTAAAAATGGGC
GCGAAAAATAAACAACCGTAACCGGGCTACAGACAAGGTGATCAGTGCTCTCGCCACGCAAACTCATGTTACAGCGCCAGACCATTCTTCATCAGTGAAG
CAAAACGCTGAAGAACCTCTGCTCGGCGCAGGCCCCCGACTGAACCCTGCCTGGGTGGGAATGGAGAGGCCTCACAGGCACTTTTTGATGTCTGAAAATA
ACGACTTCTCTTTGTTTGCTGCCTCGACGTCGTCAGGCGATGCTACGGCCACCACAACCCCATTGTCATTGATCATTTCGACAGCATCGGCAAACTCCTT
GAAATCCTTCACGCTGGTTGCGAGTATCTCTTCGCGCCTTTGCTGGCGTTCCTCCTCAGTGATTCCCAACAAATACCGCATCAGACTGCTGTAACCTTTA
GCATCTGGTAGCTGGTAGGAATCAACATCCCCTATGGTTCCAATAATAGCTTTTGTGAGAGCATCATCATCTACCTCTAGTTCTCTGAGGAACTTTGCAG
TCCCATCATAGACATCTAGTGTTTTCAGCAAGTTCGGATCACGGTATGACAAATAGGAAAAGACCCCTGAATGAGTGTCAAAATCACAAAACCCTCCATA
TGCGCCACCACTAACTCGAACGCGGTCCCATAACCATGTGTTGCTTATGTGCTTGGATATGACATAGGCACTTCCATTAAGCTGGTATCCACTTTGGTAT
AGGTTTCCAGCTTTTCCAACATAATTAACCTGTGTAGGGATAACAATGGCTTCATTAACAGAAGGCAGTCGAGAGAGCCATGGATCACTTCCCAGGGATG
GGGCACTTGGCAGTGCATCAAGAAATTTGGCAATATGTTGACCAGATTTTTCAAGATTTTTTGAGTCGCTGGTTATGTTTATCAAGCAACCTTCCTTAGA
AAATAGAGACTTCCTCATTTCCTCGAGTGATGCAGATATTCTGTCCCAATCTTGATCAATCCTCGTCTCCAGGTCTCGTAAATACTCAAGATAACTAACA
CCACCCATTTGTTCTGAAATCCATCCAGCTGCATTTAACTGGCATCCATC
page-top