Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17370  (registered. 2007)
Contig Information
Length 860 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_023828 [Oryza sativa (japonica cultivar-group)]
Score 225
Evalue 9.20849e-17
Total Hit Count 5
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17370
TGCATGAACATATCTGTTTTGCGTTCTCCTTTTGAATTACGGGACAAGGCAAGACTTCAAAGTTCAGCTAAGCTATGGTTCTTATATGGGCACACGATTA
CGCAGTTTTCTAGAAACTCCACATAGTACAGGCAAAAAAGGTAAAGAGTACGGGTATAACTCATCAGAAAAATCTCCACATAAATAAAATGAAGTAAAAG
CTTCATGAGATGGCATCCTAACAACGAGGGCACGATTCTTGCACTCGCCATTTTCATCTTTTTTCCCTTCATTTCTGGTGTCAAAAGGAATGACGGCAAA
CATCCATCACATGTTAGTTCAGGCTCATATGTTTTTGACAAGAATCAAGCCCAAACATCCGGAAAAGCACCGAACTACAGCTGAAATTCACAATTATCTG
TATAAGCTTCCTCGATTCGTCTCCTAACCCAAAACAGAAATTTGACAGATTGGCATCTGTGATGTTTTGCTTTCTACCACAAGATCATGGAATTCTCTTA
ACCAGCAACAAATTCATTCTGTGAAGGTTGAACAATTCAATGAAATTGCTGCGCATGTAACTCCTTACTCGTTTTCATGCCATCTACAGAATGCCAGACA
ATTTCACGAGTTCCTTTATCAGTAGAGTTGTCTGCCCCAAACAATTCAAGAGTCCCTTTTTCACTGGAGTTATTTGAGGGGGCGCTGTGAAGTATTTGAA
ACTGATTATTACTCATGCGCCATTCATTGACAGCGATGGCTTGGTCACTAAAATGAGAACCACTCCCGACGCCATCAGAAGGAAATGGAACTGTAACATC
AGTTGATCTTCGTGGTCGTCGGACAGGTCTGCTGCTCCTGCTAGAAGATGGGAAATTTCC
page-top