Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17364  (registered. 2007)
Contig Information
Length 879 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 707
Evalue 1.22388e-72
Total Hit Count 163
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17364
ATGCATGGTAATCTTCTTGCCGAATACAGAGGCGCACACACGATCCAATTCTTGCTTCAACCTAGGTGGGAGAGCAAGGACACGCACGACATGCTAACAC
GAGCTGCTACTCCAAACGCACTCCCCTTCTTTTGCTGTAACCACCATCACCACCACCATCACCACGAAAAAAACGTACGCAGATATATCTTCCTAACGAA
CCAACAAATCCAACAAGGCGCATTTCATATCCGCAACTGCTGTCCGTCATCATATGTCGGCTGAGAGGAAGTTGTCAGACAAGGTAACCTTCTCGCCCAA
CTTGAACGGCGCCAGGCCTCTGTATGGGCAGGTGCTGCATCGGAAAGCGTCGCCCAACCCACAACTGCCACAAGCTGAGACAGGGTTATCAATCTGTTCT
GCAGTGAGCCCCAGCTTCTCCACCTTCTGCTCAGCCTCGGCCCTGCCACAACTGCAGTTCTTGCATGCCTTCTTTGTAGCTCCCACCTCACAATCTCCTA
CTGAGGATTTGTTGGCTTTACCAACTGGAAGCTGTGGCTTCTTCAAGTCCTCCTCAGTCAAGAGGCTGTCTTCGTCAATCAGTTCATCATCATCGTCAAT
TTCAATCTTTGGAAGAGCCTTTACTGCTTTCTTCAGGGGAAAGGAAGAACCCATAATCCAAGAAGGCTTCTTTGCCTTGATAGTAACAGATTGCACGCTA
TCTTGCGAGTTTGTAGCAGAAGCTTGCACTTCAACAAAACCACCCATGAGTAGCTGGCGCTCGATATAATTGTTTGGCTTCTGGTCAGTGGAGGGTGTGA
AGCTCTGTACCAGCACAATTCCACCAGCTTTCAGCACTCGGCTAATTTCAGCAACCAACTTATCTCCAAAGCTCTCAAC
page-top