Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17293  (registered. 2007)
Contig Information
Length 1386 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194706360|gb|ACF87264.1| unknown [Zea mays]
Score 664
Evalue 2.34358e-67
Total Hit Count 43
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17293
CCGCGCGTACGAGGGGACAAACGGCGGCAAGCGGCGGCGCAGCTTGTTTCAAGGTCGGCACATCCTGTAGGCCAATTGAAGGGACGTGACTAACAGATTC
CTAGTTTTTGCTCTCCCAGTCGGCCTACCACCCCTGGACCAGCCCAAAGCCGAGTCACGGCCGCACCGCAACTCGCCAGCTTCCGCGCACCAGCTGCGCC
GCCCTCGCCAGGCAGCGATATCTCCTATCTCTCCTGCCGGCGGGTCGGTGGTTCCAGCGGACAAGATGCTGGGCGTCTCCACCAGCCAGCTTTTGGTCAT
CCTCGGGGCCTGCTCCGTGATGATGAAGCCCAGTGACATGATCAAGATGGCAAGGGTGGCAGGGAGGATGACCGGGAGAGCGGTCGGTCGCCTCATGCTC
TACCGCCGGCAGATGGACGACATCTTCGAGCAGACTGCAGCGAAGAAGATTAATACGGAGCTTCAAGATGCCATGTCAAAGTTACAATCAATTGGTTATG
AAGTTCAGAACTTGTCTAGAATAACTCCTGGCCAGTTTATCAAAAGGCAGCACAACACCGAGGGCATGACTGAAGCAGGAACATATGATGGTTCTGCAAC
TCAGTCCGGAGAATTTCGTGATGATATTCGCAGTATAATTCGTGATGAAATTGAGAGCTTTTGTAGAAAAAATCCTGATCAATTTACCAGGAGGTTAAAT
AATCCTGACGGAATTCAGAACTCTGAACAAACAGCTGAAGCTACAAAATTCGATGTAACTAATAAATATGCAATGACATCTAAGGACATGGAATCAGCGA
ATACAAGCTCTACAAATCTGCACAGCCAAGCAATGATGTATGCCAAGCTAAGTGTATCCGAAGGAATTAAGATGAGTTCTTCCATGAGTGTGAGTAATGG
AGAACAATTCAAAGAGAGCAATGGACTGCTAAATGTACTCCCAATATCAGCTGAAACTGCTGGATTGCTTCCAAAACACACAGGTGAGCCTAAAGGTTCA
GATATACTCCTGGAGGCTGTGCTTGAAGCAGAGGTTGCAGAGAACGCTAAATTTTTCGTCTCACAGCCTCATGATCAGTTGCCCAAGGAGTAACAGCATC
TTTTCATCTTTCAATAGCAGTTGATACATCGCTTGCACATTTAACTTTCTTGGTAGCTCTGAAGACAGCTTTGATGGCTGATGATGGCATGTTCTGATCT
TCACCTCAGCGGCACAATCTTACGTTCTGACGTTTTTTTAAAGGCGTTACATTCTGACTTCATGTCGATCTAAATGGAGATGGAACCGACAGAATGTTGA
GTTGACTGTTAGGGTGTAAATGTTTTGTCAAATAAATTAGGACGTAATGCTAGGCCAGTAGTAGCCTTCTTGTTTGTTAAAAAAAA
page-top