Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17291  (registered. 2007)
Contig Information
Length 737 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_016419 [Oryza sativa (japonica cultivar-group)]
Score 117
Evalue 5.68796e-06
Total Hit Count 274
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17291
ACTCGATGCGTTCGTCCGACCATAAAGACGACCATTCAACACGAAGTTCGATACAAAAGCGAGAACACATAAGAAGAGCCAACTACGGAGACATAATCTT
TAAGCATACTAACAAGTGGCGTAATTCATCTGCCTTGTCGATATACTTCACAGGGACCCGCCTCACACGAACCCGAGTCTGCAAATCATCACCAGTGGCA
ATGTTACCCACCATGCGCAGAGCTGCAATGAGAATAGAAGTCGACGGGCACAAGAGAAGCTCCACAAGCGAGGAAAAACACCAGACTCAATCACAGCAGG
AGGAACACCCTGATCTGAAGGAGGAAAGATAGTGCCACCCCCTCTTCCATGGCCAAGCACATTCCATCAAGTTTGTAGCTCAAAGCTTGACACATCAAGT
TTGGCAAAAAGGAATATATCAAAAGCTAAGCAGCTTGCTCGATTGCTCAAGAGCGCGCCTATATCAGTAATGGTCAATCATCATTGCACCATATCAGAAT
TCTTATGAACCAAACAACAACAGCAGGGTCTAGCAGTTTCCAACAGTGAACGGGATTCCAAGGCCACTTACAAACTTGCAACTCCACACTTAGTCTGACA
AAATGATGATGTCAGCCTCACGGCTTCGGTTCCATGTCTCGATAGAGCTTGTGAATAGCTCGCACTACTATCATCTCAAGCGATGGTAGCATAGGGCCCA
GATGACCCTTTTTGTTGGAGGCATGGATGAGGAACTG
page-top