Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17288  (registered. 2007)
Contig Information
Length 1039 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0679200 [Oryza sativa (japonica cultivar-group)] >gi|33146440|dbj|BAC79548.1| unknown protein [Oryza sativa Japonica Group] >gi|50509522|dbj|BAD31215.1| unknown protein [Oryza sativa Japonica Group] >gi|113612174|dbj|BAF22552.1| Os07g0679200 [Oryza sativa (japonica cultivar-group)] >gi|215741246|dbj|BAG97741.1| unnamed protein product [Oryza sativa Japonica Group]
Score 135
Evalue 4.22628e-09
Total Hit Count 54
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17288
CGCGCCCATCCTCCCAACAAAAGAATCGATGCCTGCCGCCACAATCGGCCATGAGAACACCGGCTGCTATATCCTCGCCGCCCTCTACCGCTCGCGCCAC
GGGCGTCGATCCAGCCGGGGCGCAGTCGCGGCTGGTGGTGCCATCGTCGTCCGGCAGGACCATCCCCGAGCGCCTCCCATCAAAGGATCCAGCGTCCATG
TCTGGTGTCGGGCCCCCTGCTATGGCGGCCTCGAGTGCTTGGTGCCGGTGGTGTCGTCGAGCCAAGCGCGCTGGAGCGCGGCAACGATGGCACGGTGGTG
CTCGGCGGAGTTGAGGGCAAGCTAGCGCGCGAGCAGCTCCTCGAGGCCCCGTGATAATCTCCGCCATGCTCTTCAGGAAGTCCTCCTTCGAGTCCCTCGG
CTCCTTCACCACAACGAGGCTCTCCTGCAGCCAGCACCGCCGCCTCTGCCGCATGGTGGTCACCACCGGGGGCTGCACGTCCGCTGGCCTTCTCCCCTTC
AGCTCGCTGCTCGGCTTCACGTATGGTTCGCCGTCGCTGCCTCGCCCTGGCCATCGGTCGCTGGCTGAGGTCTCCTCCTCCCTGTCGACCTTCTTTGCGG
TGCTTGGCTCTTGGGGTCCCCTTGGCGGGGCCATCAGATCGGGACGTAGTAAGATGCCCTGTTTGGGGAATGTGGCAGCGGCACCCCCTGCTGCCACGAC
GGTTGATGGCGTCACCACCGCCGGAGCACGATCACTTATGTGGTGCTCCCTTAGGAGCCCGGCGGTTGCATCATACGGCACTGCGGCGAGAGGGTGTTAC
ACTTCTTACTCTAGCTGGATTTCCTTTCTCTGCTTGCGTTGCACTTGCTGTACAGTAGGGAGCGTGGCTGGGGCAGAATGTGGAGTGAGCCGTTGTGCCA
TGCATACGCGTGCACTTTTAGTGCGGAAGTTTGCCGCACGTAGCAGTCGACGTCGCGGCCCACCAAGACTGAGGCATGCTGAATACTGTCGAGCACAAGA
TGAACATGTACAACTCTGAATCCTTTTGCTACATTGACC
page-top