Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17264  (registered. 2007)
Contig Information
Length 761 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 2
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit thylakoid lumenal 16.5 kDa protein [Zea mays]
Score 369
Evalue 1.4675e-33
Total Hit Count 41
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17264
CCGCGATACATTGGTAATCTGAGTGCAAGAACTCGCATGAATTTCTTGCAAACAAGCACTAGACGTACACGGATGAACTTACTTTTTCTTCCTCAAGATC
CTAATACACTGCAAATAATTTCTTGACACAAAAAATGTCTTTTACATCTCAACAAGGGGAAGAAAAACAGAGGGAATTGTGACTCTAACAGATTGTTTTC
CCGTCGAAACCGTGGTTACGATAGAATCAACACATGTATCAGTTGCATGGAGAACATCATCAAGCCAGCGCTTGAAGGAAAACATCATCTCCAGGTAGGT
AGGTATGTACTCGTCAGACAGCAACAATTCACTCATCTCAGAAAATTCAGAAGCCCTTGAGCTTGCCGGTGAGCCCGGCCAGCTCCACCCATTTCTCCAG
CGCCGTCGCCGACGACACGAACGCCGACTTGGACGAGTTGATGTCGCTCTTGCTCACTGATGTGAATAAGGAGGACAGCGAGGAGTTGAAGCTGTCGACC
GCGCTCTTCTCCTCACTGCTCGAGCTGAACTTGGAGAAAGCTGCATTGACGTTCTGCACCCACGGCGCGTCGGGGGCGGGGCCGAGGACGTCGCCGGCGG
CGGCGAGGTCGTCCTTGTCAATGGCCTGCCCCACCTTGCTCAGCTTGTACACCAGGTCCTGCAGGTACCCTGTCTCCGCGGCGGAGGAGCTGATGATCCC
CTGCTTCTGGAGCCGCTTCTTCTTGTCCTCCTTGACGCGCTCCAGCAGCTCCATGTCGTCG
page-top