Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11237  (registered. 2012)
Contig Information
Length 1919 bp
Clones alternative view 130 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 6
Wh_r Root 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 17
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 8
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 10
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 18
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 11
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23Ž 12
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115470235|ref|NP_001058716.1|| Os07g0108300 [Oryza sativa (japonica cultivar-group)]
Score 900
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11237
TTTTTTTTTTAACAAAGGGTGTTTAATTATTTATTATGGATCAATTATTGGAGCCAACAATTACAGTATCATCATATGTAGTAAATGGACCGAACATTTC
CGCATATAATTTCCCCCTATACATATCAAGCATAGCAACCAGTTTTCTTCACCATAGTTACAGCTTACAGCTAATTAATCAACTTCAATTGCTGGTAGAA
AAGAGCAGCATTATATTATATGTAGATGCTTTGTTTTCTTCTCTCTTCACAGCCTCGAGTGGTTCTGGTATTGCTCCATGAATGAGTCGTTGAACTTCTT
GAAGCTCGACATGATCGCCGGCATGTCCTCCTCCGCGGGCAGGATCGTCGTCCTCAGATGGAACACCCCTTCTTTCTGACCAAAACCTGAGCCTGGAACA
GTGGAAATTCCAGTGGCTTCCAGAAGCTTGAGGCAGTAGTAAACATCAGGCGCTTTGCCAGCGCTTTTGGCTACATCCATAGCTCTTTGCGGCAGGCGTA
TTTGCGGGAAAGAATACATAGCTCCTTCTGTGAAATTGCAGACAACATTTCGGCAACTATTGAAACCGTCTGTCATTATTTGTGCCCTCCTCCTCAAAGA
TTCAAGGATAGACTTACTTTCAGCAGAATACTTCAGGTACGAGATGTCTCCAGGTTTAGGAGGGTTCACCATAAGCCCCATAAAGATCTGCCCAGGAACA
TTTGGACTCAGCGCGATTGATGCAACCTTATAAATCTCGTCGACAGTCTTGGGAGGAATATTTGTCATTTCAAAGTACCCACCACGCTGTCCACACTCTC
CCCAATATCCTTTGGACACAGTATGGAAAGAAATCAGCTGAACTTCCCTGCTTACTGGAGGACCCATGTCAAACATAACCTTTCTTGCACTTATAAACGG
ACGCTCATCTTGATAAACATTCTGTTGATAAACTTCATCTGCAAGCAGAACCAAGTTTTCCTGATAGCAGAAGTTCAAAAGTTCCCTAATATTTGCTTCA
CTTAGGCATTGACCAGTAGGGTTTCCTGGGTTTATTATCACCATTGCTCGAACAGTGATTCCCTTTGACCGTGCTTCTGCAACTGATTGCCGGGTACTGA
CAAGATCAAGTCCCCAGTTAGCCTCTTCTTCCAAATAATACGGGACAAGAGAACCACCAAAGAGGGAAATAGCAGCAGAATAAAGCGGGTATTGTGGAAC
AGGGACCAAAATCCCGTCCCTCTCGTTTCTGATAATGGCGTTGAGCATTTGCATCACACCTTTGCTGGCACCATCAGTGAGGTAGATAAGCTCTGGATCA
CTTGGATACCCATCACGCCTCTGAATGAACTCGGCAACTTCCTGCCTAACCCCAGGGATACCTCGGGAGTCACTGTAAGCACCTAAACCGCCGGGTGCGA
GGGAGAGGTAGTGCTTGGCCCTCGCGATGGCATCGGCGGGGAAGATGAGGCCGACGTTGGGATCATCGAGCAGAAATGGAGCCTGGCAGAGCGCCACCAC
CTGGCGGGGGAAGGTGAGTGGCTTCTGGCCGAGGGCGTGCGGGTTGCCGACGTTGGTGAAGATGATCCTCTTGCCCTCCTTCTGGAGCTCGGAGGCGCGG
AGGTAGAGCTCCCCGCGCACGGCGTACTGCACCTTCTTGACGTTCTCGTTGAGCTCCTCGTAGTCCAGGGCCTTCCTCCCCATCATCTCCTCGTCTTCTC
CGGACGGAGGCAGATCCCTCGTGCGCCGCCGCGGAGGGGAAAGGTGGGTGTGGGGGGTGATGTGGAGAAGAAGGGAACCAAGAAACAGGGGAGCAGGTGG
GAATTTGTAGTGTAATGGCAGGGCAGAGGCAGCGAGATTCCTTGTCGCGTTGCTGGGCGTGCGCACTGCAGATTAATCAAGCGCGGATAATGTGGAGGAG
ACGAGACGGCATCCGCTCA
page-top