Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17214  (registered. 2007)
Contig Information
Length 966 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Thalassiosira pseudonana CCMP1335]
Score 85
Evalue 1.90023
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17214
CGTCTTCTTTCATTCTTCTCGGCGGAGGCGACAGGAAGGCGGAGGCGACAGGAAGGCGGAGGAACCCTAGCCGCGGAGGAACGCCCAGATCCCCAAGGCC
GGCGACGATGGCGATGGCGGCGGTTCGCTGCGCCGCGAGGAGGCTCGGTGGCTCCCTGCTCCAGCCAACGCAGGCGGCGGTCGCGGAGGAGGGACGCCGC
CTCGTGCCAAGCAGGTTCATGCGCTCCCGCCACCTCTCCACCAAGCATGCTAGCGAGACCTGGATGGAAAAGAAGATGCAGAAGTTGAGATCTATGTGGG
CCCAGTACAAGGCGGACATAGAGAGAAGGATGAGGGAACCTCCAGAAGAGGATGAGTTTAAGTTGCTTGTCGAGTCCTACGCACGTACGATTGATGGTGT
GGTCCATGGAACTGCCAAGATGGCACTTCTCTGCATCATTCCATTTGCCCTTTTTGCCGGCGACAACAACAAGGGGGTAGAAGCAGAGTCTGTTACCAAG
GAAGACCAGTGAAGACAAACATCCAAAGACGAGAACCAAAGATGGACCCCTACTTGTTTTCAGTTAAATTATGATGACCTGCAGTTTCGCTAGCGAGCAC
TATGCTATCGTTGTGATTTTGTGTAACATGGTACCATCTATTCGACATGAAACTTGTAGGTTGATGAGAACATGCATTGCATAGCTTGTATGGTCACTGG
CATGCATTTTGCTGCTACTGGAGTGCTTGAATCAACTTAGAGGTGTTAACTCTTCTTCTGAAACTAATTGTGTGACGTTATCCTTTCACTTCATGACTGC
CCTGTGTTTTTCCCCATCACCAAAGGGGCGGGCTCGTCTTGTACAGATCCTCTTAACTTCATGGCTGCCCTGTTTTTCTCCTGTCACCAAGGGGCGTGCT
AGCCTTGATCTATTCATTCTGGGCGTTCTTTCTCATCAACATGAGGTTATTTATTTAAAAAAAAAA
page-top