Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17193  (registered. 2007)
Contig Information
Length 1340 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit charged multivesicular body protein 4b [Zea mays]
Score 456
Evalue 2.96254e-43
Total Hit Count 391
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17193
GTCTTCATACTTAGTTACCTCACTCCTTACCAGTTACTTCCATTTGATTAATTCCTTCAATTATTTATTACTCCCTCCGATCCAAAATAATTGCCGCAGT
TTTGAACTGGGGTTAGTTCAAAACTGCGTCACTTATTATGCATCTGAGGTAGTATAGACTTACATTTTTCTTTGAAGATGAAAACACACCTATAATTGTT
TTTCTAGACTATTTTTGACGAGTTAGCTACTACAGTACTTCTAAATAATGTTTCTGTGCTTTTCAGTTTTTTTTCTACTACCTTTTCAATGTTGGTGCAA
AAATGCACCAGCTATGCCTGTTGGCTGTTGTGCTGCTAGTGACCTACCTAGAAAATATTATTCCTTCCTACAATTCCATGTATGCTCTGGATATTGTCGA
AAACACATATTCGTCTTTCCTTTTTCATTCAGCCGAGGGGCAGGCCTGGCGCAGTGGTGAAGTCCTCCCCACTTGTGCCAAGAGGTCCTGGGTTCGAACC
AGCCTCTCTGCATTGCACTTTGCAGGGCTGCAATACAATGTCTGAAGAGGAAGAGATTATATGAGCAACAGGTGGAGCAGCTTGGGAATTTCCAATTGAG
GATTCATGATCAGATGATAATGCTGGAAGGTGCAAAAGCTACAACAGAGACTGTGGATGCATTGAGAACCGGAGCATCAGCAATGAAAGCTATGCACAAA
TCAACAAATATTGATGATGTTGACAAAACCATGGACGAAATTAATGACAACATGGAGAACATGCGGCAGATCCAGGATCTACTATCTGCGCCTATGGGAG
CAGCAAGTGATTTCGATGAAGATGAGCTGGAAGCTGAACTTGCGGATTTGGAGGGTGAGGAGTTGGAGGCACAGCTACTAGCACCTACCACAAGTGCTCC
TATGACTGCTCCAGCGCGTGTACCTCAGCAGTCGAGTCGGCCCACTGCGCAGAGCAGTAAAACTGAAGACGATGAGCTGGCAGCTTTACAAGCTGAGATG
GCTATGTAATTAGTTTGCAGGACTTGGCGTGGTCATGTTTAGAGACCAGATTGTGCAAATATATTTGGGACCACGGTATTTTCATGGAGGTCTTCCTGGG
AAGACGTCAGAAGTACACACAGAAACTAGATGCATCTCACCCTGATGGTCTCTTATGTATATCTTATCATGTTACTTTTGTAATCAAACATCTAAGATGC
GCTGTCGAGCGCATTATCAGCTAATAAAGGGCATCTGCCATCATTGTATATTTCTATATAAAGTGAGTTAGTTGACCGACCACTCAACTTTTATTTCCTA
CTACTAGCTAGCCTGTGCGTGGAANCGGGGGCACACACAT
page-top