Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17151  (registered. 2007)
Contig Information
Length 933 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 705
Evalue 2.31083e-72
Total Hit Count 94
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17151
TTTTTTTTTTGGCACACGTTCTCTTTGTGTTCATCTCACAACGGGCAACATTGCTCTACATGGATCTTCACATTCACACATACACGAAACAAGTTGTACT
AGTTGCTCCCAGTACAATTTACTCCCACACACAAGTTCTCGCCTTATTGCTAGTTGCTACCATCACGCTGCCTAGGCTACACAACTCACAAGTGCTTAGG
TCCTCGGTACAGTTCACACAACTCACATCAGTAGCCAGTAGGAACTCAACTCCATCAACACTTCCCTTAGGTCTCAGCTGAAGCTCATATCAGACCTCAG
GAAGGCCGTCATCACATCAGGAAGAACGGCGAAGGGAGCAGGGGCCGGACGCTCCTGCGCACGTCCAAGCCCCGGAGGCGCTCCAGGTTCATCACCTCGG
AGTGGTCGACGAAGAGGTTCACCCGTGGGCCGTATCGTTTGACGAACCACTCAGAGGTGTTGGCACCGGACGTCTCGAACATGGTTCTCTCGAGCCCGAG
CCGGCCGACGATCTTCGCGATGATGTCCGCCCTGAGCGAGTCCGCGCGCTGGCACACGTCGTCGGCATCGATCATGATCATATCCGCACCTGCCTCCAGG
CATCTCTCGGCCCTCCTGATAAGCAGGTCAATGTCTTCGACTCTTTCTGAGCTCTGCTTCACTGGAGCTATGTAAGCCCCAAACGCCCTATCACCAGCTG
CAGGGATATCAGAGCTGTCGAACTTGACTGAAAACAGGGGCTTGGCTCGCAAGCCAGTGTTCTTTATGAGGCGGACTAGTCTCAGGATAGCCTCTTCAGG
GAGCTTGAGAGATCCGGCGTTGAGCTCAATGGTGTCGAATCCCAACTCCTTGCATTCCTGCAACAATACATTTTATGCCACGTACAGGCTTCAGGCACGT
TTGTGCGCATATGACATACAACCAGGACAGCAA
page-top