Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17060  (registered. 2007)
Contig Information
Length 1754 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0511600 [Oryza sativa (japonica cultivar-group)] >gi|110289392|gb|ABB47879.2| prolyl carboxypeptidase like protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639649|dbj|BAF26954.1| Os10g0511600 [Oryza sativa (japonica cultivar-group)]
Score 2016
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17060
GCGCCTCCCTCCTCGGCGCCTCCTTCCTCCTGCTCCTGCGCAGCGCCGAGCCGCTCGGGTTCAACCACCGCCCGACGACCGCCGGCGACGAGCTCTCGGC
CGCCCCGAGCAGATACCTGACGCGGGAGGAGCGCTGGATGAGCCAGCGCCTCGACCACTTCTCCCCCACCGACCACCGCCAATTCAAGCAGCGCTACTTC
GAGTTCCTGGACTACCACGACGACCCTAACGGCCCGGTGTTCCTGCGCATCTGCGGCGAGTCCTCCTGCGACGGCCTCCCCAACGACTACCTGGCCGTCA
TCGCCAAGAAGTTCGGCGCGGCGGTGGTGACGCCGGAGCACCGGTACTACGGCAAGAGCTCCCCGTTCGACAGCCTCACCACCGACAACCTCAGGTTCCT
CTCGTCCAAGCAGGCGCTCTTCGACCTCGCCGTCTTCCGCCAGTATTACCAGGAAAAACTGAATTCTCAGTACAACCGGAGCGCGGGGTTCGACAATCCG
TGGTTCGTCTTCGGGGTCTCCTACTCCGGGGCTCTCAGCGCATGGTTCAGGCTCAAGTTCCCTCACCTGACATGCGGAAGCCTCGCCAGCTCCGGGGTGG
TTCTTGCTGTGTACAACTTCACTGATTTCGACAAGCAGGTCGGAGAGTCGGCTGGCCCTCAGTGCAAAGCCGCCCTTCAGGAAATAACTAGACTTGTCGA
CGAACAGCTTCGGTTGGATAGCCACTCTGTGAAGGCCTTGTTCGGAGCAGATTCGTTGAAAAATGACGGCGACTTCCTCTTTCTTCTGGCAGATGCAGCA
GCCACAACATTCCAGTATGGGAATCCTGATGCCTTGTGCTCTCCTCTAGCTAATGCGAAGAAAAAGGGGGAAAGTTTGGTGGAAACATATGCTCACTTTG
TGAAAGATTACTTCATTAAAAAATTGGGGACTACAGTATCTTCTTATGATCAAGAGTATTTGAAGGAAACAACTCCCGATGATTCTAGTTCTAGACTTTG
GTGGTTCCAAGTTTGCAGTGAAGTTGCCTATTTTCAAGTCGCACCCAAAAATGATAGTGTTCGTTCTGCGCAGCTTAATACAAGGTACAATTTGGACCTG
TGTAAAAATGTTTATGGAGAAGGAGTTTATCCTGATGTGTTCATGACAAACTTATATTATGGAGGCACAAGTATTGCTGCTTCTAAAATTGTGTTTACAA
ATGGCTCTCAAGATCCATGGCGTCATGCCTCCAAACAGAATTCATCGGAAGACATGCCATCATACATAATCAAATGTAGCAACTGCGGACATGGCACTGA
TTTGAGAGGATGTCCCCAGCTTCCTTTCAGGATTGAAGGTGACTCTTCAAACTGCACGTCCCCAGAAGCTGTGAACACAGTAAGGAAGCAGATCGTCAAG
CACATCGACCTGTGGCTATCACAATGCCATGAACCAACAAGGGCGTGGTGAGGTGACGATGACTCGCACCTGTTTAGGAGTAAAAGAAGCAGTGTGTAGA
GGAAGGACCGATTGCAAGTTTGCGACATCGTTATGCTGCAGACCGAGTGAACTATATGCGGATTGAGCAGCCAGTCCCCGGCCTGGATGCGATTGCGCGC
AGGTTTGTTTGGATTATCACAAACGGTAGAAAGTTATGTTTGTACTGCTGCCGACTAGAGCCATCATGGCAACTTTGTCGAGTTCAAATAATCATATACA
TCGTTCATGAGGCTTTTAAGAATAAAGGTAGGGGGTTCTTCAAACCAAGGCTAT
page-top