Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11220  (registered. 2012)
Contig Information
Length 797 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 1
WH_XE Seedling, infected with leaf rust 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125540905|gb|EAY87300.1|| hypothetical protein OsI_08703 [Oryza sativa Indica Group]
Score 276
Evalue 3.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11220
AGACAGCAACGCTGATATCAGTTCAGTATTTTTTTTTTCGAGAATAACAGCACTGCTATTATTTAATTTTCACAGGTGCTATCAGTTCAGTACACCAGAG
CATGAGCATCCACTATAACTTAACAGGGGGATCAAATGGACATATACTTAGCATGGATATAGATAGGGTTGTGTCGAAAATAGACCGGCGCAACCTCGTT
ATGTCAACAAAGTTGAATGAAGATACAAGTATCAGCTTGGATTATCGCAATTCGCATTCTGACCATAGAAGGCAGACCAACGAGTCACCAAGTCACCAGA
TTAATCGGCGGTCTGTGTGCACCTAAAGTGCAACCTTCCCTTTCAGATTGATCGCCGAGAGCTCTTGTTCCACATACTCCCCGGCACATATAGGCGGATA
ACTATGAGCATTGGGTGCTTCAGCAAAGTGGCCCAATGGCTTAAGCGTCGCATCGGAAGCAATGTGCGAGAATAGCGTTGATGAGATCCTCCACAAGCTT
CGGTTCTGCTCTTTAGCTAGTTCTATTGCCTCTAATGTTCTCTTGGTCACCACTACCTCATGCATTCCAGCTAAACATTCACCACCAGTAAGCCATTCCA
ACTGTTTCCCTGACTGAATGAGAAGACAGCCAACAGGAACCTTCACCTCCATCTTTTTACCATTTCTTAACCAAATGTTCAGGCCTGGAAATCTACTACG
GCCATGTATGGTCAAGAAATTAAGATCATAATGGAACCCAGCAAACACAGTCCCCGTGCAGAACCATGACGCAGCAGATTACTTCCCGTTGGTGCTA
page-top