Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17043  (registered. 2007)
Contig Information
Length 799 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_V4816 Shoot grown under cold condition for 16days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_010681 [Oryza sativa (japonica cultivar-group)]
Score 817
Evalue 1.82949e-85
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17043
TTTTTTTTTTATAAAAGGCGTCATCTTTATTCGGAGAATAAAACGGACGAGCTTTAACCCCACTCACACACCAACGCACCTTACAATCAATTTCATCGCC
CTTTAAAGTACACGCAACCTTTCTTTCTATACTTCTATCTTCAGTTTCCTTTTCCTATCCGGCAGACAGGATCTGCTCCGGGTCCTCCTCCCCTAGCTGG
CTGGAGACTGGGTTATGCCAGCGATCATGCTCAGTGCCATGCAAGGCTGGTCGGCCGGCACGAAGTGGCCGGCGCCGAGGATCCAGTAGAAATGCAGGTT
CTTGTAGGATCTGACGAAGGCCTTGGTGACCTTGGATGATCCGCAGGACAGAGGCTGCCTCGGCAGGCTCAGGAAGTTCTTCAGCCCATCCCATTTGAGC
TTTTGCACCCATGCTTCCGCGCCGTTGGTCGAGCAAATCACATCCAGCTGGCCATTATAAACCGTGACATCTACGCCGTAAGACAGCAGCTCGTCGACCT
CGTCGATCCGTGGCTTCATGAAGTCGTTGACCAGCGCGTTGTAGACGGGGTCCGACAGCTCGTGCCACTCGTGATCTTTGGGGATGATCTTGAGCTTCTC
CTTGACGACCCCGTTCATGATGCCGCCGAGGGTGTTGGTGGTGTTGGAGCCGGCTTCCTCCTGGCTGCCGCCGAGGTACGTCGAGTACTTCATCACTTGC
GCGCTGCTCGACGTCNTCGGAGTCNACNANGTCNCCGGTANGTCCGCGGNCACCGGGTCCATGCCNNCNTCNANCAANAAATTGTACATGTCNACNCTG
page-top