Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16992  (registered. 2007)
Contig Information
Length 749 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glycerophosphodiester phosphodiesterase [Zea mays]
Score 512
Evalue 3.8566e-54
Total Hit Count 148
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16992
CCGGCGTCCTGCAAGCCATCCTAAAGGTTGTTTTTGAGCATGCCAAGGACAGGCCCGCTCATTTTCTCCAGCTTCCAGCCCGACGCCGCGCAGCATTATG
CGAAGACTGCAAGACCAGTACCCTGTTTACTTCCTGACGGTTGGAGGGACGCAGCTCCACGCCGACGCACGGCGGAACTCGCTGGAGGAGGCTGTCAGGC
TGTGCCGCGCCGGCGGCCTGCAGGGCATCNTGTCGGAGGCCAGGGCGGTGTTCCGGCACCCGTCGGCGGTAGCCAGGGTCAAGGAGTCCGACCTCTCCCT
GCTCACCTACGGGCAGCTCAACAACGTGCCGGAGGCGGTGTACATGCAGCACCTGATGGGGGTGGACGGCGTGATCGTCGACCTGGTGCAGGAGATCGCC
GAGGCCGTTTCGGAGTTCGCGGCCGTGGTCGCACCGGAGCCCAGCCCCGAAGAAGGCCAGGCCGGAAGGTTGGGACTGGATAGGGCTGCGCCGGCGAAGA
AGACGCCCAACTTCTCGCAGCGGGAGATTTCCTTCCTGCTGAGGCTCATACCCGAGCTCGTACAGTAGCGCGTCTTCTTCTCGGATAGTAGTATCCACGG
TGCGCCCGTGTAGGTTGACCAATCTTTGACACCTCGGAACTGAAACCCCAAGGCCCGGATGCGGCATGTAAATCAGGGCCACCACGACCCGTCCGATTGT
TTGCATCAGGGTGAAATCCACTAGTGTTTGTGCCTGTGTAAAAAAAAAA
page-top