Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16840  (registered. 2007)
Contig Information
Length 906 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit U6 snRNA-associated Sm-like protein LSm4 [Zea mays]
Score 507
Evalue 2.00898e-49
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16840
CTCACAACCAACAAATAGGTAAAATCTGGGCTGGAACTTTGCAAATACATGTTGACTAGTACGCATAATGCCCATACCCAAAATATTAGGACATCCAACT
CCTCGGTAACTTCATACCACACAAACCGTTTGCCATACCATACCGCAAAACCCAGCAATTCCAGCTCCAAAGTTTTTCATGTCCTAAGCAATCTATGCAA
CACCACAACTACAGGCCTTAAAAAGCGGCATTCTCGCATCTCAAGATCCGTCTTACCCACGACCACGTCCGCCTTTGTTGCCACCTTTACTTCCAATTCC
GCCCCTTCCACGGCCACCGCCTTTGCCATCATCTTGGCCACGACCAATGCCTCTGCCTCCAGGTTTAGTGCCTATATCTCCTCTTCCTCTTCCACGACCA
ACACCTGGTGGCTTCCTATCTGATCTACTCTTAGAAGTTTCCTCTTGAACCTTGTCAATCACCTCATCAGGAACCCGAAGATACTTGATCGTGTTACCAC
GAATATAGCACTCCGGCATCCTCCAAAACTTATCACCATCCTTAGAGGTGCAAATAACCTCCCGGAGGTGGATGTTCATCCACGTGTCGCAGTTCACCAA
GTGCCCATTGTAGGTCTCGCCGTTCTTGAGCTCCACGAGCATGGGATGCCCCTGGGCGGTCTTGAGGAGCGAGAGGGGAAGCATCTTGAGCGAGATCCGG
AGATTGAAAAAAAGTCCGGATCGGCGGATGGAGACGCCGAGCTGGATCGCCGCCGGGGCGGGAAGGAGGCGGCGGCTCCGGGGGAAGATTGCGGGAGCAA
AACCCTAAATTTGGCCGCCGGGTCGTGTCGGTAAAGAGGGGGAGATGAGACGAGGCGGAGAACTCGCGAGCCCTATAGTAGGCACGGCAAACCTCGCCCT
CGTGCC
page-top