Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16778  (registered. 2007)
Contig Information
Length 731 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group] >gi|218201604|gb|EEC84031.1| hypothetical protein OsI_30261 [Oryza sativa Indica Group]
Score 674
Evalue 5.86519e-69
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16778
TTTCAACCACAACATTATATATAACAGGTACTGGAATGATCTTGATGAACATATATATTGTTCCATCAGAATCACAGCTCAGGGGAAACAGTAGTGGTCT
TTCATCATCTTCATTAACCAGGACACGCGCAAAATTCGATAAAAACTACGACAAGTAGACATATTTAAGCTTGAACATAGTAAGGAGGTCCAGTACTGTA
GGTAGCATTGATATAGGGCGGCAGGGGCACGAGCTTAGAACACCCGGACCGGCTTCCCCATGGTGCTCTTGATGTACAGACACCTCACGTTCTGCCAGTT
CTTCTTGAGCAGGGAAACCAGGAAGTTGACGCTCATCTGGATGTTCTGCTGGATCTGCTTCTCCTCCATCGACAGGTTGCCCACCGCGACGCCCATGCAC
AGCACCTTCTTGAGCTGGAACTTGATTGTCGCTTTCGTCTCGTTCACCTTGGCTTCCAGAGACTCCTGGTGAGAAACCAGGGTCGGGAACTTTCCTGCCT
TGTTGAGACCAGGACCAAGGAGACGTGGAATCTGCTTGATGATAGCCTCCGAGGCCAAGAAAGCATGGTACTTCTTGGCAAGCCTCTTGACAAGCTTCTT
GTTCTTGTTCATCTTCTTAAGAGCTTCAACATCCATGGAATCAAGACCAATCTTTTCAGCCTCTCCCACATGCTGGGCGTCACCGAGCATGCAGACCCTC
ATCTTGGGGCGAGGGACGTGGGGGCAGCTTG
page-top